ProBound fit generated on May 21, 2021

Status

±

Terminal Output
Builder file created
Configuration file
ProBound run
Sequence logos
Terminal output
Pipeline Output:
> Converts the configuration file to work on run server, checks input
  OK
> Builds configuration file
  OK
> Runs ProBound
  OK
> Runs Model Viewer
  OK

Configuration Builder File

±

ProBound builder configuration file:
[{"function": "optimizerSetting", "nThreads": 20, "lambdaL2": 1e-06}, {"function": "addTable", "leftFlank": "GGTAGTGGAGGTGGGCCTGG", "nColumns": 2, "transliterate": {"out": [], "in": []}, "modeledColumns": [0, 1], "countTableFile": "jobs/028cc79587bf/countTable.0.tsv.gz", "rightFlank": "CCAGGGAGGTGGAGTAGG", "inputFileType": "tsv.gz", "variableRegionLength": 16}, {"function": "addTable", "leftFlank": "GGTAGTGGAGGGCACCCTGG", "nColumns": 2, "transliterate": {"out": ["cg"], "in": ["CG"]}, "modeledColumns": [0, 1], "countTableFile": "jobs/028cc79587bf/countTable.1.tsv.gz", "rightFlank": "CCAGGGAGGTGGAGTAGG", "inputFileType": "tsv.gz", "variableRegionLength": 16}, {"function": "addTable", "leftFlank": "GGTAGTGGAGGTGGGCCTGG", "nColumns": 2, "transliterate": {"out": [], "in": []}, "modeledColumns": [0, 1], "countTableFile": "jobs/028cc79587bf/countTable.2.tsv.gz", "rightFlank": "CCAGGGAGGTGGAGTAGG", "inputFileType": "tsv.gz", "variableRegionLength": 16}, {"function": "addTable", "leftFlank": "GGTAGTGGAGGGCACCCTGG", "nColumns": 2, "transliterate": {"out": ["cg"], "in": ["CG"]}, "modeledColumns": [0, 1], "countTableFile": "jobs/028cc79587bf/countTable.3.tsv.gz", "rightFlank": "CCAGGGAGGTGGAGTAGG", "inputFileType": "tsv.gz", "variableRegionLength": 16}, {"function": "addTable", "leftFlank": "GGTAGTGGAGGTGGGCCTGG", "nColumns": 2, "transliterate": {"out": [], "in": []}, "modeledColumns": [0, 1], "countTableFile": "jobs/028cc79587bf/countTable.4.tsv.gz", "rightFlank": "CCAGGGAGGTGGAGTAGG", "inputFileType": "tsv.gz", "variableRegionLength": 16}, {"function": "addTable", "leftFlank": "GGTAGTGGAGGGCACCCTGG", "nColumns": 2, "transliterate": {"out": ["cg"], "in": ["CG"]}, "modeledColumns": [0, 1], "countTableFile": "jobs/028cc79587bf/countTable.5.tsv.gz", "rightFlank": "CCAGGGAGGTGGAGTAGG", "inputFileType": "tsv.gz", "variableRegionLength": 16}, {"function": "addSELEX", "bindingModes": [0, 1]}, {"function": "addSELEX", "bindingModes": [0, 1]}, {"function": "addSELEX", "bindingModes": [0, 2]}, {"function": "addSELEX", "bindingModes": [0, 2]}, {"function": "addSELEX", "bindingModes": [0, 1, 2, 3]}, {"function": "addSELEX", "bindingModes": [0, 1, 2, 3]}, {"function": "setAlphabet", "letterComplement": "C-G,A-T,c-g", "letterOrder": "ACGTcg"}, {"function": "addNS"}, {"function": "addBindingMode", "flankLength": 3, "dinucleotideDistance": 1, "size": 12}, {"function": "addBindingMode", "flankLength": 3, "dinucleotideDistance": 1, "size": 12}, {"function": "addBindingMode", "flankLength": 3, "dinucleotideDistance": 1, "size": 12}, {"function": "bindingModeSeed", "index": 1, "mononucleotideIUPAC": "NNTGACGTCANN"}, {"function": "bindingModeSeed", "index": 2, "mononucleotideIUPAC": "NNTTGCGCAANN"}, {"function": "bindingModeSeed", "index": 3, "mononucleotideIUPAC": "NNTTGCATCANN"}, {"function": "symmetry", "index": 1, "symmetryString": "1:12:1"}, {"function": "symmetry", "index": 2, "symmetryString": "1:12:1"}, {"function": "bindingModeConstraints", "index": 1, "maxFlankLength": -1, "fittingStages": [{"optimizeFlankLength": true}]}, {"function": "bindingModeConstraints", "index": 2, "maxFlankLength": -1, "fittingStages": [{"optimizeFlankLength": true}]}, {"function": "bindingModeConstraints", "index": 3, "maxFlankLength": -1, "fittingStages": [{"optimizeFlankLength": true}]}, {"function": "output", "outputPath": "jobs/028cc79587bf", "baseName": "fit", "storeHessian": false, "printTrajectory": false}]

Configuration File

±

ProBound configuration file:
{
  "modelSeeding": {"bindingModes": [
    {"seedScale": 1},
    {
      "mononucleotideIUPAC": "NNTGACGTCANN",
      "seedScale": 1
    },
    {
      "mononucleotideIUPAC": "NNTTGCGCAANN",
      "seedScale": 1
    },
    {
      "mononucleotideIUPAC": "NNTTGCATCANN",
      "seedScale": 1
    }
  ]},
  "optimizerSetting": {
    "nThreads": 20,
    "likelihoodThreshold": 0,
    "lambdaL2": 1.0E-6,
    "patternSearchSettings": {},
    "pseudocount": 0,
    "minimizerType": "lbfgs",
    "nRetries": 3,
    "hkSettings": {},
    "output": {
      "storeHessian": false,
      "outputPath": "jobs/028cc79587bf",
      "printTrajectory": false,
      "baseName": "fit",
      "printPSAM": false,
      "verbose": true
    },
    "lbfgsSettings": {},
    "sgdSettings": {},
    "fixedLibrarySize": false,
    "expBound": 40,
    "slbfgs_plsSettings": {},
    "slbfgsSettings": {}
  },
  "modelSettings": {
    "enrichmentModel": [
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [-1],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          1
        ],
        "modifications": []
      },
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [-1],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          1
        ],
        "modifications": []
      },
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [-1],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          2
        ],
        "modifications": []
      },
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [-1],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          2
        ],
        "modifications": []
      },
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [-1],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          1,
          2,
          3
        ],
        "modifications": []
      },
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [-1],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          1,
          2,
          3
        ],
        "modifications": []
      }
    ],
    "letterOrder": "ACGTcg",
    "countTable": [
      {
        "leftFlank": "GGTAGTGGAGGTGGGCCTGG",
        "transliterate": {
          "in": [],
          "out": []
        },
        "variableRegionLength": 16,
        "modeledColumns": [
          0,
          1
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 2,
        "rightFlank": "CCAGGGAGGTGGAGTAGG",
        "countTableFile": "jobs/028cc79587bf/countTable.0.tsv.gz"
      },
      {
        "leftFlank": "GGTAGTGGAGGGCACCCTGG",
        "transliterate": {
          "in": ["CG"],
          "out": ["cg"]
        },
        "variableRegionLength": 16,
        "modeledColumns": [
          0,
          1
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 2,
        "rightFlank": "CCAGGGAGGTGGAGTAGG",
        "countTableFile": "jobs/028cc79587bf/countTable.1.tsv.gz"
      },
      {
        "leftFlank": "GGTAGTGGAGGTGGGCCTGG",
        "transliterate": {
          "in": [],
          "out": []
        },
        "variableRegionLength": 16,
        "modeledColumns": [
          0,
          1
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 2,
        "rightFlank": "CCAGGGAGGTGGAGTAGG",
        "countTableFile": "jobs/028cc79587bf/countTable.2.tsv.gz"
      },
      {
        "leftFlank": "GGTAGTGGAGGGCACCCTGG",
        "transliterate": {
          "in": ["CG"],
          "out": ["cg"]
        },
        "variableRegionLength": 16,
        "modeledColumns": [
          0,
          1
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 2,
        "rightFlank": "CCAGGGAGGTGGAGTAGG",
        "countTableFile": "jobs/028cc79587bf/countTable.3.tsv.gz"
      },
      {
        "leftFlank": "GGTAGTGGAGGTGGGCCTGG",
        "transliterate": {
          "in": [],
          "out": []
        },
        "variableRegionLength": 16,
        "modeledColumns": [
          0,
          1
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 2,
        "rightFlank": "CCAGGGAGGTGGAGTAGG",
        "countTableFile": "jobs/028cc79587bf/countTable.4.tsv.gz"
      },
      {
        "leftFlank": "GGTAGTGGAGGGCACCCTGG",
        "transliterate": {
          "in": ["CG"],
          "out": ["cg"]
        },
        "variableRegionLength": 16,
        "modeledColumns": [
          0,
          1
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 2,
        "rightFlank": "CCAGGGAGGTGGAGTAGG",
        "countTableFile": "jobs/028cc79587bf/countTable.5.tsv.gz"
      }
    ],
    "bindingModeInteractions": [],
    "bindingModes": [
      {
        "size": 0,
        "fitLogActivity": true,
        "flankLength": 0,
        "dinucleotideDistance": 0,
        "positionBias": false,
        "singleStrand": false,
        "modifications": []
      },
      {
        "size": 12,
        "fitLogActivity": true,
        "flankLength": 3,
        "dinucleotideDistance": 1,
        "positionBias": false,
        "singleStrand": false,
        "modifications": []
      },
      {
        "size": 12,
        "fitLogActivity": true,
        "flankLength": 3,
        "dinucleotideDistance": 1,
        "positionBias": false,
        "singleStrand": false,
        "modifications": []
      },
      {
        "size": 12,
        "fitLogActivity": true,
        "flankLength": 3,
        "dinucleotideDistance": 1,
        "positionBias": false,
        "singleStrand": false,
        "modifications": []
      }
    ],
    "letterComplement": "C-G,A-T,c-g"
  },
  "modelFittingConstraints": {
    "enrichmentModel": [
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      },
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      },
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      },
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      },
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      },
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      }
    ],
    "nShifts": 0,
    "countTable": [
      {},
      {},
      {},
      {},
      {},
      {}
    ],
    "addBindingModesSequentially": true,
    "flankLengths": [0],
    "bindingModeInteractions": [],
    "singleModeLengthSweep": false,
    "bindingModes": [
      {
        "maxFlankLength": -1,
        "positionBiasBinWidth": 1,
        "optimizeSizeHeuristic": false,
        "maxSize": -1,
        "optimizeFlankLength": false,
        "symmetryString": "null",
        "roundSpecificActivity": true,
        "informationThreshold": 0.1,
        "optimizeMotifShift": false,
        "fittingStages": [],
        "optimizeMotifShiftHeuristic": false,
        "experimentSpecificPositionBias": true,
        "minSize": -1,
        "experimentSpecificActivity": true,
        "optimizeSize": false
      },
      {
        "maxFlankLength": -1,
        "positionBiasBinWidth": 1,
        "optimizeSizeHeuristic": false,
        "maxSize": -1,
        "symmetryString": "1:12:1",
        "optimizeFlankLength": false,
        "roundSpecificActivity": true,
        "informationThreshold": 0.1,
        "optimizeMotifShift": false,
        "fittingStages": [{"optimizeFlankLength": true}],
        "optimizeMotifShiftHeuristic": false,
        "experimentSpecificPositionBias": true,
        "minSize": -1,
        "experimentSpecificActivity": true,
        "optimizeSize": false
      },
      {
        "maxFlankLength": -1,
        "positionBiasBinWidth": 1,
        "optimizeSizeHeuristic": false,
        "maxSize": -1,
        "symmetryString": "1:12:1",
        "optimizeFlankLength": false,
        "roundSpecificActivity": true,
        "informationThreshold": 0.1,
        "optimizeMotifShift": false,
        "fittingStages": [{"optimizeFlankLength": true}],
        "optimizeMotifShiftHeuristic": false,
        "experimentSpecificPositionBias": true,
        "minSize": -1,
        "experimentSpecificActivity": true,
        "optimizeSize": false
      },
      {
        "maxFlankLength": -1,
        "positionBiasBinWidth": 1,
        "optimizeSizeHeuristic": false,
        "maxSize": -1,
        "optimizeFlankLength": false,
        "symmetryString": "null",
        "roundSpecificActivity": true,
        "informationThreshold": 0.1,
        "optimizeMotifShift": false,
        "fittingStages": [{"optimizeFlankLength": true}],
        "optimizeMotifShiftHeuristic": false,
        "experimentSpecificPositionBias": true,
        "minSize": -1,
        "experimentSpecificActivity": true,
        "optimizeSize": false
      }
    ]
  }
}

Probound Text Output

±

Output from ProBound:
> Reading configuration JSON object and validating general schema.
> Validating configuration schema.
{"enrichmentModel":[{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true}],"nShifts":0,"countTable":[{},{},{},{},{},{}],"addBindingModesSequentially":true,"flankLengths":[0],"bindingModeInteractions":[],"singleModeLengthSweep":false,"bindingModes":[{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"symmetryString":"1:12:1","optimizeFlankLength":false,"roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[{"optimizeFlankLength":true}],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"symmetryString":"1:12:1","optimizeFlankLength":false,"roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[{"optimizeFlankLength":true}],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[{"optimizeFlankLength":true}],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false}]}
Entry=bindingModes, aEntry=[{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"symmetryString":"1:12:1","optimizeFlankLength":false,"roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[{"optimizeFlankLength":true}],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"symmetryString":"1:12:1","optimizeFlankLength":false,"roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[{"optimizeFlankLength":true}],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[{"optimizeFlankLength":true}],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false}]
Entry=bindingModeInteractions, aEntry=[]
Entry=countTable, aEntry=[{},{},{},{},{},{}]
Entry=enrichmentModel, aEntry=[{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true}]
> Builds likelihood object.
>> Creating CombinedLikelihood object.
Alphabet
========
Letter Complement: C-G,A-T,c-g
Letter Order:      ACGTcg

Optimizer settings:
===================
lambdaL2         = 1.0E-6
pseudocount      = 0.0
expBound         = 40.0
fixedLibrarySize = false

>> Determining fitting order.

 Summary of experiments 
 ====================== 
Experiment 0:
-------------
Count table:      Count table 0
Enrichment model: SELEX enrichment model 0
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 1
Binding mode interactions: 
                  NONE

Experiment 1:
-------------
Count table:      Count table 1
Enrichment model: SELEX enrichment model 1
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 1
Binding mode interactions: 
                  NONE

Experiment 2:
-------------
Count table:      Count table 2
Enrichment model: SELEX enrichment model 2
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 2
Binding mode interactions: 
                  NONE

Experiment 3:
-------------
Count table:      Count table 3
Enrichment model: SELEX enrichment model 3
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 2
Binding mode interactions: 
                  NONE

Experiment 4:
-------------
Count table:      Count table 4
Enrichment model: SELEX enrichment model 4
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 1
                  Binding mode 2
                  Binding mode 3
Binding mode interactions: 
                  NONE

Experiment 5:
-------------
Count table:      Count table 5
Enrichment model: SELEX enrichment model 5
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 1
                  Binding mode 2
                  Binding mode 3
Binding mode interactions: 
                  NONE

> Builds optimizer.
> Using LBFGS.
> Starting optimization.

==================================
== Starts fiting Binding mode 0 ==
==================================
> Optimizing h (component0-0-h).
>>  Starting new optimization: component0-0-h. (2021-05-21 17:37:11.546).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[0,1]},{"h":[2,3]},{"h":[4,5]},{"h":[6,7]},{"h":[8,9]},{"h":[10,11]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 19.57574989472101
gradient      = {0.4985,-0.4985,0.4985,-0.4985,0.4985,-0.4985,0.4985,-0.4985,0.4985,-0.4985,0.4985,-0.4985}
gradient norm = 1.7269640210564523
Starting Function Value: 19.57574989472101
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3   11.062902444957464    5.000000000000000    2.895254295420296    1.643023212672335
         2            6    4.207045274381962    5.860638839938574    0.059883117667176    0.216813353632106
         3            8    4.159665150563106    0.435816217734139    0.489165518227999    0.000047927308380
         4            9    4.159665148265752    0.435816217734139    1.000000000000000    0.000000252842292
Convergence criteria met.
After: gradient norm = 2.528422923229409E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {-3.2610,3.2610}

Count Table 1:
---------------
h:                 {-3.2610,3.2610}

Count Table 2:
---------------
h:                 {-3.2610,3.2610}

Count Table 3:
---------------
h:                 {-3.2610,3.2610}

Count Table 4:
---------------
h:                 {-3.2610,3.2610}

Count Table 5:
---------------
h:                 {-3.2610,3.2610}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-6.5221,-6.5221}
Activity(exp=1):   {-6.5221,-6.5221}
Activity(exp=2):   {-6.5221,-6.5221}
Activity(exp=3):   {-6.5221,-6.5221}
Activity(exp=4):   {-6.5221,-6.5221}
Activity(exp=5):   {-6.5221,-6.5221}

Binding mode 1:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

> Initial optimization (component0-1-f0).
>>  Starting new optimization: component0-1-f0. (2021-05-21 17:37:13.887).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[12,13]},{"h":[14,15]},{"h":[16,17]},{"h":[18,19]},{"h":[20,21]},{"h":[22,23]}],"bindingModeInteractions":[],"bindingModes":[{"mononucleotide":[],"activity":[[0,1],[2,3],[4,5],[6,7],[8,9],[10,11]]},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.159665148265788
gradient      = {-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 5.7453394037333876E-5
Starting Function Value: 4.159665148265788
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    4.159665138563716    0.000336176802172    5.851295781645478    0.000105583564313
         2            8    4.159660057040529    0.101752521958794   341.00000000000000    0.000289800026203
         3            9    4.159253338985963   12.527502405381975    1.000000000000000    0.010004647851826
         4           10    4.159090653272278    8.363758733097090    1.000000000000000    0.008249142305080
         5           11    4.159030702080374    4.587978340639318    1.000000000000000    0.002296346396012
         6           12    4.159027181014656    0.094123273676940    1.000000000000000    0.000262710274379
         7           13    4.159027083794044    0.206444843159598    1.000000000000000    0.000001444698735
         8           14    4.159027083360867    0.020165513549312    1.000000000000000    0.000000752986817
         9           15    4.159027083359936    0.000642730906487    1.000000000000000    0.000000117556625
        10           17    4.159027083359694    0.000642730906487    0.476344660332781    0.000000005145978
Convergence criteria met.
After: gradient norm = 5.1459781416649426E-9
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {-0.0000,0.0000}

Count Table 1:
---------------
h:                 {-0.0000,0.0000}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Count Table 5:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Suggested variations:
key=0;0;0, description = Initial model.
> Optimizing variation "Initial model." (component0-2-variation0).
>>  Starting new optimization: component0-2-variation0. (2021-05-21 17:37:17.313).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[12,13]},{"h":[14,15]},{"h":[16,17]},{"h":[18,19]},{"h":[20,21]},{"h":[22,23]}],"bindingModeInteractions":[],"bindingModes":[{"mononucleotide":[],"activity":[[0,1],[2,3],[4,5],[6,7],[8,9],[10,11]]},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.159027083359694
gradient      = {-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000}
gradient norm = 5.145978142397992E-9
Already at minimum!
After: gradient norm = 5.145978142397992E-9
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {-0.0000,0.0000}

Count Table 1:
---------------
h:                 {-0.0000,0.0000}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Count Table 5:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID NOT improve. Discarding fit component0-2-variation0.
> No varitions possible for Binding mode 0.
> Optimizing the full model (component0-4-all).
>>  Starting new optimization: component0-4-all. (2021-05-21 17:37:17.416).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[12,13]},{"h":[14,15]},{"h":[16,17]},{"h":[18,19]},{"h":[20,21]},{"h":[22,23]}],"bindingModeInteractions":[],"bindingModes":[{"mononucleotide":[],"activity":[[0,1],[2,3],[4,5],[6,7],[8,9],[10,11]]},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.159027083359693
gradient      = {-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000}
gradient norm = 5.14597814335047E-9
Already at minimum!
After: gradient norm = 5.14597814335047E-9
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {-0.0000,0.0000}

Count Table 1:
---------------
h:                 {-0.0000,0.0000}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Count Table 5:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}


==================================
== Starts fiting Binding mode 1 ==
==================================
> Optimizing h (component1-0-h).
>>  Starting new optimization: component1-0-h. (2021-05-21 17:37:18.561).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[0,1]},{"h":[2,3]},{"h":[4,5]},{"h":[6,7]},{"h":[8,9]},{"h":[10,11]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 5.9587461362956375
gradient      = {-0.4091,0.4091,-0.3530,0.3530,0.0000,-0.0000,0.0000,-0.0000,-0.4112,0.4112,-0.3496,0.3496}
gradient norm = 1.080130940022073
Starting Function Value: 5.9587461362956375
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            2    4.994256366159390    1.000000000000000    0.925813679570705    0.831076435683376
         2            3    4.559180511618635    3.488627072442732    1.000000000000000    0.607301414641249
         3            4    4.085110380117674    1.498268653176909    1.000000000000000    0.013803526992747
         4            5    4.084905739822959    0.031764746843728    1.000000000000000    0.001051416970840
         5            6    4.084904558041338    0.002276480934096    1.000000000000000    0.000029206963132
         6            7    4.084904557120656    0.000065766506016    1.000000000000000    0.000001323127694
         7            8    4.084904557118734    0.000065766506016    1.000000000000000    0.000000005514180
Convergence criteria met.
After: gradient norm = 5.514179561110607E-9
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {1.2020,-1.2020}

Count Table 1:
---------------
h:                 {0.9371,-0.9371}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {1.2065,-1.2065}

Count Table 5:
---------------
h:                 {0.9243,-0.9243}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {4.3714,4.3714}
Activity(exp=1):   {4.3714,4.3714}
Activity(exp=2):   {4.3714,4.3714}
Activity(exp=3):   {4.3714,4.3714}
Activity(exp=4):   {4.3714,4.3714}
Activity(exp=5):   {4.3714,4.3714}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

> Initial optimization (component1-1-f1).
>>  Starting new optimization: component1-1-f1. (2021-05-21 17:37:23.046).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.084904557118739
gradient      = {0.0260,0.0024,-0.0041,-0.0065,0.0022,0.0138,0.0226,-0.0460,-0.0033,-0.0041,0.0303,0.0343,0.0192,0.0114,-0.0151,-0.0033,-0.0257,0.0472,0.0275,0.0079,-0.0100,-0.0151,-0.0555,0.0788,0.0310,0.0132,-0.0077,-0.0100,0.0094,-0.0022,0.0525,0.0070,-0.0272,-0.0077,-0.0369,0.0460,0.0000,0.0018,0.0000,0.0079,0.0000,0.0000,0.0000,0.0000,0.0000,0.0003,0.0000,0.0070,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000}
gradient norm = 0.16835321871252276
Starting Function Value: 4.084904557118739
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    4.068616239871060    0.202771132299751    1.204438702452134    0.349277252467740
         2            4    4.043571156546170    0.178034645333041    1.000000000000000    0.273822388330584
         3            5    4.014924967822506    1.115684115209343    1.000000000000000    0.471187843044275
         4            6    3.988463378095106    0.465081584411050    1.000000000000000    0.096016361573677
         5            7    3.982249784607501    0.131954730197187    1.000000000000000    0.095080332412090
         6            8    3.962583762026198    0.494766289905423    1.000000000000000    0.137083316636775
         7            9    3.950741364850019    0.261366952133320    1.000000000000000    0.105930583546013
         8           10    3.939378510728392    0.407184243341067    1.000000000000000    0.038051590797213
         9           11    3.937614099854339    0.115987648398792    1.000000000000000    0.038029402399636
        10           12    3.936630375539764    0.097099510921722    1.000000000000000    0.033762666273870
        11           13    3.933429894812325    0.299312320623876    1.000000000000000    0.022919897543118
        12           14    3.930466250370126    0.366592451404960    1.000000000000000    0.058856588755537
        13           15    3.927350506608474    0.357739337598478    1.000000000000000    0.089271492110253
        14           16    3.921877319840601    0.633145712861253    1.000000000000000    0.136342661411296
        15           17    3.915460940621373    0.476460766919530    1.000000000000000    0.132915873573207
        16           18    3.905118843978161    0.712585743916691    1.000000000000000    0.163037488930812
        17           19    3.903086203582593    0.655917118587197    1.000000000000000    0.072644466458865
        18           20    3.892031782279337    0.543549005933838    1.000000000000000    0.091267417345118
        19           21    3.889171713155891    0.138667999073819    1.000000000000000    0.066738498219484
        20           22    3.885452726416730    0.281276331711904    1.000000000000000    0.036828046778388
        21           23    3.883012089637117    0.272127431977939    1.000000000000000    0.029420738616802
        22           24    3.877828376145299    0.562745191061392    1.000000000000000    0.025608395441627
        23           25    3.873448521010464    1.129771524617296    1.000000000000000    0.062245220906954
        24           26    3.868606690255301    0.508215316926366    1.000000000000000    0.037137400972762
        25           27    3.865753867545624    0.409613034264606    1.000000000000000    0.021446295350158
        26           28    3.863259178252795    0.757087006703340    1.000000000000000    0.020576524914203
        27           29    3.861450886010073    0.556648829360390    1.000000000000000    0.020400990989946
        28           30    3.859188665432268    1.133218349512814    1.000000000000000    0.024787013948919
        29           31    3.857546836168735    0.610395675079581    1.000000000000000    0.013475200248787
        30           32    3.856562114937791    0.253174451057171    1.000000000000000    0.013455924073217
        31           33    3.855623075333841    0.312660897743296    1.000000000000000    0.009994013002358
        32           34    3.854697388570515    0.273599712874888    1.000000000000000    0.007709930669948
        33           35    3.853838312313743    0.330954612591465    1.000000000000000    0.010845408167124
        34           36    3.853231550274284    0.274068916879132    1.000000000000000    0.010819434810878
        35           37    3.852654902345160    0.499477543622095    1.000000000000000    0.009948813743822
        36           38    3.852342890778049    0.379773628100039    1.000000000000000    0.003482606613642
        37           39    3.852256810478512    0.195637293793564    1.000000000000000    0.002336551871349
        38           40    3.852176409463129    0.171070443867097    1.000000000000000    0.001994207257528
        39           41    3.852080852834453    0.173743951244489    1.000000000000000    0.002055851789355
        40           42    3.851978680554441    0.182642523486034    1.000000000000000    0.002930553259236
        41           44    3.851951274927671    0.067271732751690    0.205725731629000    0.002871881584959
        42           45    3.851910342912307    0.082358351066642    1.000000000000000    0.001298451761017
        43           46    3.851891972022663    0.052837083272258    1.000000000000000    0.001180204362502
        44           47    3.851874016640998    0.039371397653532    1.000000000000000    0.001116564810796
        45           48    3.851851112994206    0.067459284977167    1.000000000000000    0.000986843098887
        46           49    3.851834701853413    0.072704263034659    1.000000000000000    0.000846134361967
        47           51    3.851832351009846    0.016887605075811    0.173159569168611    0.001480819584834
        48           52    3.851822826346417    0.059054894270464    1.000000000000000    0.000884800140171
        49           53    3.851815594892214    0.035958285887829    1.000000000000000    0.000716826731853
        50           54    3.851801256086118    0.085747110869734    1.000000000000000    0.000678180846537
        51           55    3.851789020457685    0.073850194945486    1.000000000000000    0.000637939027637
        52           56    3.851773123451782    0.106656330601196    1.000000000000000    0.000557122321032
        53           57    3.851756600807917    0.133333383871145    1.000000000000000    0.000780289026874
        54           58    3.851739186490796    0.193106695799340    1.000000000000000    0.000624534608965
        55           59    3.851729771762136    0.133110455560554    1.000000000000000    0.000488049496520
        56           60    3.851723350491378    0.101718795228653    1.000000000000000    0.000385290329985
        57           61    3.851720204217982    0.046852827945062    1.000000000000000    0.000210612074296
        58           62    3.851718730376776    0.021794102937134    1.000000000000000    0.000201687851726
        59           63    3.851717346908573    0.021476027117642    1.000000000000000    0.000208387040135
        60           64    3.851715145265799    0.042419257250508    1.000000000000000    0.000247165077270
        61           65    3.851712537572855    0.062648652139739    1.000000000000000    0.000211196640987
        62           66    3.851710243432387    0.069856642441638    1.000000000000000    0.000164294954909
        63           67    3.851708364690540    0.053359361546951    1.000000000000000    0.000262724567270
        64           68    3.851706012784435    0.071155643085904    1.000000000000000    0.000403770006666
        65           69    3.851703941358782    0.059316032317811    1.000000000000000    0.000461554352872
        66           70    3.851700197767271    0.108009845701105    1.000000000000000    0.000436422283556
        67           71    3.851695307142141    0.163580895660695    1.000000000000000    0.000307295113035
        68           72    3.851691399307458    0.181349759241741    1.000000000000000    0.000235040502342
        69           73    3.851689471390043    0.107832446159790    1.000000000000000    0.000221426633919
        70           74    3.851688823784228    0.040453749504275    1.000000000000000    0.000148032318246
        71           75    3.851688223274952    0.044976174468686    1.000000000000000    0.000096161052719
        72           76    3.851687620732168    0.042801210239527    1.000000000000000    0.000077234951101
        73           77    3.851686850310878    0.057478768373931    1.000000000000000    0.000100834469701
        74           78    3.851685977478367    0.052025273135193    1.000000000000000    0.000149960172964
        75           79    3.851684167623704    0.111156828979912    1.000000000000000    0.000167332110141
        76           80    3.851681988518464    0.126129447187096    1.000000000000000    0.000278532997093
        77           81    3.851678612508517    0.193012107072998    1.000000000000000    0.000270858487259
        78           82    3.851674341241396    0.243320779080507    1.000000000000000    0.000284425930457
        79           83    3.851668675173618    0.361851487235877    1.000000000000000    0.000297556247746
        80           84    3.851664329587679    0.311366616446581    1.000000000000000    0.000256447332912
        81           85    3.851660710398617    0.287631567667006    1.000000000000000    0.000250034840236
        82           86    3.851656904228633    0.395831806411637    1.000000000000000    0.000281089043810
        83           87    3.851653234875922    0.429586193988550    1.000000000000000    0.000240283218033
        84           88    3.851649167028266    0.530392377836537    1.000000000000000    0.000207540313526
        85           89    3.851644064793459    0.576342846702489    1.000000000000000    0.000209624870774
        86           90    3.851635288220856    0.955454683176267    1.000000000000000    0.000253320852709
        87           91    3.851622228103257    1.253048912781838    1.000000000000000    0.000430430448128
        88           92    3.851597172692499    2.132438681708477    1.000000000000000    0.000467742725532
        89           93    3.851565768419913    2.916684995257545    1.000000000000000    0.001192933652660
        90           94    3.851528846243465    1.362421116565003    1.000000000000000    0.000570148837131
        91           96    3.851506146330444    0.860135227772857    0.462833296685404    0.000344724185068
        92           97    3.851496766837482    0.297870435244864    1.000000000000000    0.000288789597313
        93           98    3.851494006121746    0.096469740644771    1.000000000000000    0.000418999249571
        94           99    3.851492634583295    0.064939381897718    1.000000000000000    0.000287780742491
        95          100    3.851491785062688    0.115058214092042    1.000000000000000    0.000106021828544
        96          101    3.851491339492908    0.041805977505410    1.000000000000000    0.000075269825482
        97          102    3.851490978539207    0.029442199273530    1.000000000000000    0.000081100866705
        98          103    3.851490412986370    0.034026722144734    1.000000000000000    0.000115021921636
        99          104    3.851489730353474    0.040955054103513    1.000000000000000    0.000154171697198
       100          105    3.851488451749606    0.077968426197287    1.000000000000000    0.000192498467969
       101          106    3.851486118115107    0.141846438286986    1.000000000000000    0.000222222765267
       102          107    3.851481578981015    0.356730515297022    1.000000000000000    0.000412423645025
       103          108    3.851474491208517    0.561800331225063    1.000000000000000    0.000293646298667
       104          109    3.851464695389869    0.507066175070668    1.000000000000000    0.000436279124155
       105          110    3.851447241224886    1.240636090035912    1.000000000000000    0.000923272224146
       106          111    3.851438309550156    0.717087366183609    1.000000000000000    0.000893269136701
       107          112    3.851428304352594    1.483951273509424    1.000000000000000    0.000903775112866
       108          113    3.851425373633977    0.565542179423370    1.000000000000000    0.000592712615300
       109          114    3.851420326385227    0.246016615110655    1.000000000000000    0.000150608684856
       110          115    3.851420097222203    0.096088547561013    1.000000000000000    0.000078671376951
       111          116    3.851419997973771    0.034912690952008    1.000000000000000    0.000082990462232
       112          117    3.851419942851718    0.035108225903152    1.000000000000000    0.000048162252891
       113          118    3.851419913553030    0.014671627323428    1.000000000000000    0.000024718199432
       114          119    3.851419903364964    0.002968824603794    1.000000000000000    0.000012256250107
       115          120    3.851419899650148    0.007499765449587    1.000000000000000    0.000005545594907
       116          121    3.851419897986769    0.002332815082972    1.000000000000000    0.000009037258290
       117          122    3.851419895379371    0.003986073182012    1.000000000000000    0.000006650018983
       118          123    3.851419891682425    0.002289954325437    1.000000000000000    0.000007590614463
       119          124    3.851419883489088    0.004753677979313    1.000000000000000    0.000023388925422
       120          125    3.851419874558122    0.005755588871374    1.000000000000000    0.000017069379527
       121          126    3.851419857809344    0.010559000939149    1.000000000000000    0.000025038772215
       122          127    3.851419825211173    0.019613511593831    1.000000000000000    0.000030621241696
       123          128    3.851419759436378    0.034142064621691    1.000000000000000    0.000036838176811
       124          129    3.851419567936238    0.104214592267732    1.000000000000000    0.000119071941392
       125          130    3.851419219408298    0.175111176599149    1.000000000000000    0.000103760125281
       126          131    3.851418588157344    0.387090905127026    1.000000000000000    0.000219417810889
       127          132    3.851418129479175    0.287356559911792    1.000000000000000    0.000119550992716
       128          133    3.851417953216948    0.055151615675210    1.000000000000000    0.000067563553943
       129          135    3.851417929408739    0.018478032108827    0.442286959684269    0.000048806832218
       130          136    3.851417919205737    0.029490487230219    1.000000000000000    0.000014030750385
       131          137    3.851417917038509    0.005390766286147    1.000000000000000    0.000022602044824
       132          138    3.851417913639569    0.001551714583695    1.000000000000000    0.000012075339786
       133          139    3.851417912703200    0.009205136974295    1.000000000000000    0.000003144980385
       134          140    3.851417912661231    0.001820760198036    1.000000000000000    0.000001859713374
       135          141    3.851417912654473    0.001820760198036    1.000000000000000    0.000000726992024
Convergence criteria met.
After: gradient norm = 7.269920242561924E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0892,-0.0892}

Count Table 1:
---------------
h:                 {0.0624,-0.0624}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {0.2128,-0.2128}

Count Table 5:
---------------
h:                 {0.2928,-0.2928}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-1.2798,-1.7294,-0.8429,-0.9854,-1.2249,-1.3367,0.1830,-0.8795,-0.8825,-2.4404,-2.1548,-1.2249,-2.0592,-2.1706,-3.8430,2.2982,0.4829,-2.1548,-3.2818,-3.3709,0.1277,0.4392,-1.8436,0.4829,1.3103,-3.2111,0.1479,-0.8616,-2.9886,-1.8436,-2.7284,1.0336,-2.9234,-0.1367,0.2969,-2.9886,-0.1367,-2.9234,1.0336,-2.7284,-2.9886,0.2969,-0.8616,0.1479,-3.2111,1.3103,-1.8436,-2.9886,0.4392,0.1277,-3.3709,-3.2818,0.4829,-1.8436,2.2982,-3.8430,-2.1706,-2.0592,-2.1548,0.4829,-2.4404,-0.8825,-0.8795,0.1830,-1.2249,-2.1548,-0.9854,-0.8429,-1.7294,-1.2798,-1.3367,-1.2249}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0487,-2.8054}
Activity(exp=1):   {0.0487,-2.9551}
Activity(exp=2):   {0.0487,0.0487}
Activity(exp=3):   {0.0487,0.0487}
Activity(exp=4):   {0.0487,-1.2631}
Activity(exp=5):   {0.0487,-0.7233}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Suggested variations:
key=12;3;0, description = Initial model.
> Optimizing variation "Initial model." (component1-2-variation0).
>>  Starting new optimization: component1-2-variation0. (2021-05-21 17:39:05.752).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 3.851417912654472
gradient      = {0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000}
gradient norm = 7.269920242559412E-7
Already at minimum!
After: gradient norm = 7.269920242559412E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0892,-0.0892}

Count Table 1:
---------------
h:                 {0.0624,-0.0624}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {0.2128,-0.2128}

Count Table 5:
---------------
h:                 {0.2928,-0.2928}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-1.2798,-1.7294,-0.8429,-0.9854,-1.2249,-1.3367,0.1830,-0.8795,-0.8825,-2.4404,-2.1548,-1.2249,-2.0592,-2.1706,-3.8430,2.2982,0.4829,-2.1548,-3.2818,-3.3709,0.1277,0.4392,-1.8436,0.4829,1.3103,-3.2111,0.1479,-0.8616,-2.9886,-1.8436,-2.7284,1.0336,-2.9234,-0.1367,0.2969,-2.9886,-0.1367,-2.9234,1.0336,-2.7284,-2.9886,0.2969,-0.8616,0.1479,-3.2111,1.3103,-1.8436,-2.9886,0.4392,0.1277,-3.3709,-3.2818,0.4829,-1.8436,2.2982,-3.8430,-2.1706,-2.0592,-2.1548,0.4829,-2.4404,-0.8825,-0.8795,0.1830,-1.2249,-2.1548,-0.9854,-0.8429,-1.7294,-1.2798,-1.3367,-1.2249}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0487,-2.8054}
Activity(exp=1):   {0.0487,-2.9551}
Activity(exp=2):   {0.0487,0.0487}
Activity(exp=3):   {0.0487,0.0487}
Activity(exp=4):   {0.0487,-1.2631}
Activity(exp=5):   {0.0487,-0.7233}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;4;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component1-2-variation1).
>>  Starting new optimization: component1-2-variation1. (2021-05-21 17:39:06.47).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 3.85141107007079
gradient      = {-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 8.070492213321876E-5
Starting Function Value: 3.85141107007079
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.851411061310897    0.000213562740765    2.646217047483320    0.000032292018046
         2            4    3.851411059553862    0.000083181749777    1.000000000000000    0.000016897571204
         3            5    3.851411058330341    0.000104947632646    1.000000000000000    0.000015541405675
         4            6    3.851411056557521    0.000197490136737    1.000000000000000    0.000022137304411
         5            7    3.851411053674869    0.000449845515387    1.000000000000000    0.000027469356755
         6            8    3.851411053134884    0.000593995071115    1.000000000000000    0.000045971443395
         7            9    3.851411050769565    0.000117071369182    1.000000000000000    0.000014538827949
         8           10    3.851411050072553    0.000066723431541    1.000000000000000    0.000011362510462
         9           11    3.851411048974771    0.000182144426926    1.000000000000000    0.000019056898963
        10           12    3.851411046928241    0.000432475780507    1.000000000000000    0.000029814378767
        11           13    3.851411043348121    0.000894205372969    1.000000000000000    0.000034889463817
        12           14    3.851411040805933    0.001531254869856    1.000000000000000    0.000064615663632
        13           15    3.851411035535276    0.000822690314444    1.000000000000000    0.000023115021822
        14           16    3.851411033078261    0.000435672634949    1.000000000000000    0.000011841777360
        15           17    3.851411031409338    0.000492573605705    1.000000000000000    0.000020017469484
        16           18    3.851411029493324    0.000636415225035    1.000000000000000    0.000021392098531
        17           19    3.851411024340573    0.001919778247495    1.000000000000000    0.000043928889547
        18           20    3.851411017486097    0.002726975434660    1.000000000000000    0.000022807199141
        19           21    3.851411013341926    0.001294400760953    1.000000000000000    0.000024824496842
        20           22    3.851411010315690    0.001092159801123    1.000000000000000    0.000023462021698
        21           23    3.851411008307700    0.000197123985927    1.000000000000000    0.000018155643363
        22           24    3.851411001966473    0.001471261316638    1.000000000000000    0.000025542417409
        23           25    3.851410997825715    0.001839184272339    1.000000000000000    0.000028679892799
        24           26    3.851410992707713    0.002525302095480    1.000000000000000    0.000015378343310
        25           27    3.851410990442977    0.001387524073318    1.000000000000000    0.000006781225745
        26           28    3.851410989465245    0.000596542839242    1.000000000000000    0.000009159323925
        27           29    3.851410988725882    0.000309684503133    1.000000000000000    0.000008011949511
        28           30    3.851410987766425    0.000501941925673    1.000000000000000    0.000005093493395
        29           32    3.851410987620489    0.000129909880919    0.292598442945516    0.000010290746523
        30           33    3.851410987301489    0.000254741009103    1.000000000000000    0.000004166616646
        31           34    3.851410987182834    0.000081080779304    1.000000000000000    0.000003361466945
        32           35    3.851410986916597    0.000263658080412    1.000000000000000    0.000002653459765
        33           36    3.851410986797313    0.000154294346391    1.000000000000000    0.000001838606815
        34           37    3.851410986659737    0.000224368239527    1.000000000000000    0.000001519404850
        35           38    3.851410986545520    0.000218869476332    1.000000000000000    0.000001892441588
        36           39    3.851410986389229    0.000339757931049    1.000000000000000    0.000002573568688
        37           40    3.851410986268752    0.000382569241802    1.000000000000000    0.000002060386706
        38           41    3.851410986210689    0.000382569241802    1.000000000000000    0.000001018130838
Convergence criteria met.
After: gradient norm = 1.0181308379700185E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0892,-0.0892}

Count Table 1:
---------------
h:                 {0.0624,-0.0624}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {0.2130,-0.2130}

Count Table 5:
---------------
h:                 {0.2930,-0.2930}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-1.2790,-1.7282,-0.8423,-0.9849,-1.2243,-1.3363,0.1833,-0.8789,-0.8820,-2.4379,-2.1553,-1.2243,-2.0624,-2.1742,-3.8247,2.2939,0.4813,-2.1553,-3.2801,-3.3691,0.1285,0.4407,-1.8428,0.4813,1.3108,-3.2094,0.1488,-0.8605,-2.9885,-1.8428,-2.7268,1.0342,-2.9220,-0.1357,0.2973,-2.9885,-0.1357,-2.9220,1.0342,-2.7268,-2.9885,0.2973,-0.8605,0.1488,-3.2094,1.3108,-1.8428,-2.9885,0.4407,0.1285,-3.3691,-3.2801,0.4813,-1.8428,2.2939,-3.8247,-2.1742,-2.0624,-2.1553,0.4813,-2.4379,-0.8820,-0.8789,0.1833,-1.2243,-2.1553,-0.9849,-0.8423,-1.7282,-1.2790,-1.3363,-1.2243}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0482,-2.8034}
Activity(exp=1):   {0.0482,-2.9533}
Activity(exp=2):   {0.0482,0.0482}
Activity(exp=3):   {0.0482,0.0482}
Activity(exp=4):   {0.0482,-1.2620}
Activity(exp=5):   {0.0482,-0.7223}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;5;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component1-2-variation2).
>>  Starting new optimization: component1-2-variation2. (2021-05-21 17:39:38.596).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 3.867919760788682
gradient      = {0.0363,0.0075,0.0009,0.0011,0.0078,0.0111,0.0393,0.0146,0.0000,0.0009,0.0021,0.0078,0.0006,0.0007,0.0024,0.0000,0.0607,0.0001,0.0008,0.0007,0.0000,0.0024,0.0158,0.0449,0.0005,0.0203,0.0000,0.0000,0.0037,0.0400,0.0318,0.0017,0.0068,0.0000,0.0227,0.0016,0.0000,0.0043,0.0000,0.0022,0.0000,0.0000,0.0000,0.0000,0.0000,0.0121,0.0000,0.0137,-0.0107,0.0107,-0.0067,0.0067,-0.0000,0.0000,-0.0000,0.0000,-0.0290,0.0290,-0.0272,0.0272}
gradient norm = 0.12963267102165552
Starting Function Value: 3.867919760788682
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.855922325568042    0.187088222883921    1.443218144079339    0.030099515767307
         2            4    3.854736576388585    0.043201752034382    1.000000000000000    0.026553928185539
         3            5    3.848905260965976    0.500573476290930    1.000000000000000    0.022095819921183
         4            7    3.848391303266392    0.060894478845927    0.311310208148879    0.009017319237230
         5            8    3.848288065587241    0.019902547660599    1.000000000000000    0.004498852763621
         6            9    3.848213028343169    0.022942999012892    1.000000000000000    0.005001368362920
         7           10    3.848096470379123    0.049569794882745    1.000000000000000    0.007140032741223
         8           11    3.847943204586475    0.083875264902339    1.000000000000000    0.006949535066435
         9           12    3.847863289141937    0.096543027950720    1.000000000000000    0.007187016956839
        10           13    3.847813124602085    0.033801256552631    1.000000000000000    0.001774546221776
        11           14    3.847805420145338    0.016866069905384    1.000000000000000    0.000822797881100
        12           15    3.847801664320646    0.008151590031220    1.000000000000000    0.000850559729810
        13           16    3.847795386480400    0.020689448109342    1.000000000000000    0.001105217826993
        14           17    3.847794357540841    0.023510146593500    1.000000000000000    0.001533276417493
        15           18    3.847790294002372    0.007857650256639    1.000000000000000    0.000471634435893
        16           19    3.847789095994718    0.005103327935290    1.000000000000000    0.000431404332389
        17           20    3.847787305136373    0.009451883504708    1.000000000000000    0.000557970343278
        18           21    3.847785009299388    0.013768152981296    1.000000000000000    0.000498608156612
        19           22    3.847781486464349    0.024964296024308    1.000000000000000    0.000443446998178
        20           24    3.847780410492595    0.013822841856795    0.397929799716867    0.000750664459164
        21           25    3.847778741252564    0.018445455671839    1.000000000000000    0.000333710892718
        22           26    3.847778226529344    0.005311578469622    1.000000000000000    0.000232149894339
        23           27    3.847777595168128    0.008871151808374    1.000000000000000    0.000279647562458
        24           28    3.847777130388633    0.006416436017105    1.000000000000000    0.000179156943454
        25           29    3.847776799317810    0.005999847638630    1.000000000000000    0.000202784462413
        26           30    3.847776222512792    0.009267795071023    1.000000000000000    0.000201918198277
        27           31    3.847775002665573    0.024459816849708    1.000000000000000    0.000178339833241
        28           32    3.847774336204709    0.025418673781731    1.000000000000000    0.000550911470494
        29           33    3.847773991935192    0.020030685657022    1.000000000000000    0.000337630879380
        30           34    3.847773757644598    0.010194076123832    1.000000000000000    0.000088003691798
        31           35    3.847773716866842    0.001753709944852    1.000000000000000    0.000080416019153
        32           36    3.847773605452353    0.003008466143720    1.000000000000000    0.000094657509233
        33           37    3.847773385392149    0.007632492496385    1.000000000000000    0.000131058094551
        34           38    3.847773131841876    0.011463023988429    1.000000000000000    0.000119494600508
        35           39    3.847772881627274    0.016039295217402    1.000000000000000    0.000103776375519
        36           40    3.847772840988984    0.008271889927285    1.000000000000000    0.000084602409986
        37           41    3.847772784144627    0.002822805062557    1.000000000000000    0.000030483987042
        38           42    3.847772767712977    0.000962874089278    1.000000000000000    0.000021393397671
        39           43    3.847772734809351    0.003385680224391    1.000000000000000    0.000029858003280
        40           44    3.847772715111239    0.003048539551633    1.000000000000000    0.000027528948077
        41           45    3.847772692973987    0.004092408805853    1.000000000000000    0.000014499875608
        42           46    3.847772679617109    0.003468850831054    1.000000000000000    0.000015837228057
        43           47    3.847772671995012    0.002245153939571    1.000000000000000    0.000019802892704
        44           48    3.847772663522693    0.002610001312069    1.000000000000000    0.000017228043541
        45           49    3.847772655278383    0.003545636195126    1.000000000000000    0.000021730390239
        46           50    3.847772649156696    0.001362910050904    1.000000000000000    0.000012688104060
        47           51    3.847772644248685    0.001525909267826    1.000000000000000    0.000015393281298
        48           52    3.847772640016748    0.001627478633216    1.000000000000000    0.000015302005471
        49           53    3.847772629875997    0.004173429154724    1.000000000000000    0.000013977830455
        50           54    3.847772617794529    0.006032059700680    1.000000000000000    0.000010718742139
        51           55    3.847772610061651    0.004566657634115    1.000000000000000    0.000009697980600
        52           56    3.847772605823188    0.002492686927363    1.000000000000000    0.000007955035257
        53           57    3.847772603732340    0.001059305558411    1.000000000000000    0.000005901423583
        54           58    3.847772602063871    0.000852872836836    1.000000000000000    0.000004076507393
        55           59    3.847772600768681    0.000926972866688    1.000000000000000    0.000003473800170
        56           60    3.847772599780542    0.000951015864216    1.000000000000000    0.000004558945347
        57           61    3.847772598413106    0.001457001248803    1.000000000000000    0.000005434220582
        58           62    3.847772595658391    0.002950651914997    1.000000000000000    0.000008374646861
        59           63    3.847772591185872    0.005211019362488    1.000000000000000    0.000008900755386
        60           64    3.847772586836600    0.005347063028327    1.000000000000000    0.000007181578782
        61           65    3.847772583422970    0.003810279976526    1.000000000000000    0.000006443451707
        62           66    3.847772580995469    0.002088372600814    1.000000000000000    0.000005775690450
        63           67    3.847772578774138    0.001760233197290    1.000000000000000    0.000006247107519
        64           68    3.847772575865190    0.003305804619070    1.000000000000000    0.000006969452948
        65           69    3.847772573856991    0.003615150501478    1.000000000000000    0.000005529390144
        66           70    3.847772572892107    0.001497608248496    1.000000000000000    0.000003346302771
        67           71    3.847772572193797    0.001105577754384    1.000000000000000    0.000003626670254
        68           72    3.847772571382495    0.001064716810005    1.000000000000000    0.000003128937366
        69           73    3.847772570331470    0.001494181633713    1.000000000000000    0.000003317030844
        70           74    3.847772569680522    0.001244205694418    1.000000000000000    0.000002073203634
        71           75    3.847772569196992    0.000953803443010    1.000000000000000    0.000002991565828
        72           76    3.847772568446489    0.001700752060404    1.000000000000000    0.000003173637191
        73           77    3.847772568096161    0.001082428657711    1.000000000000000    0.000002132691323
        74           78    3.847772568022757    0.001082428657711    1.000000000000000    0.000000508346535
Convergence criteria met.
After: gradient norm = 5.083465347827953E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0963,-0.0963}

Count Table 1:
---------------
h:                 {0.0664,-0.0664}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {0.2451,-0.2451}

Count Table 5:
---------------
h:                 {0.3177,-0.3177}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-1.2173,-2.2926,-0.6864,-0.8696,-1.1950,-1.2985,0.2639,-1.2362,-0.8274,-2.4035,-2.1613,-1.1950,-2.0820,-2.2866,-3.8250,2.2823,0.4733,-2.1613,-3.3134,-3.4405,-0.0283,0.5762,-1.8666,0.4733,1.3722,-3.2868,0.0081,-0.7975,-3.0287,-1.8666,-2.7376,0.9967,-2.9204,-0.1676,0.2582,-3.0287,-0.1676,-2.9204,0.9967,-2.7376,-3.0287,0.2582,-0.7975,0.0081,-3.2868,1.3722,-1.8666,-3.0287,0.5762,-0.0283,-3.4405,-3.3134,0.4733,-1.8666,2.2823,-3.8250,-2.2866,-2.0820,-2.1613,0.4733,-2.4035,-0.8274,-1.2362,0.2639,-1.1950,-2.1613,-0.8696,-0.6864,-2.2926,-1.2173,-1.2985,-1.1950}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0447,-2.7847}
Activity(exp=1):   {0.0447,-2.9546}
Activity(exp=2):   {0.0447,0.0447}
Activity(exp=3):   {0.0447,0.0447}
Activity(exp=4):   {0.0447,-1.2402}
Activity(exp=5):   {0.0447,-0.8239}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;6;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component1-2-variation3).
>>  Starting new optimization: component1-2-variation3. (2021-05-21 17:40:44.368).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 3.8477670061692804
gradient      = {-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0001,0.0001,-0.0000,0.0000}
gradient norm = 9.772569374206116E-5
Starting Function Value: 3.8477670061692804
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.847766994760780    0.000229499074953    2.348400570666421    0.000042479978254
         2            4    3.847766992323651    0.000096135683890    1.000000000000000    0.000017066832068
         3            5    3.847766991547730    0.000071341788050    1.000000000000000    0.000012297174305
         4            6    3.847766990750935    0.000093138052446    1.000000000000000    0.000015292955864
         5            7    3.847766988606425    0.000334562616898    1.000000000000000    0.000021722531229
         6            8    3.847766987696093    0.000446319679700    1.000000000000000    0.000039943357271
         7            9    3.847766985796735    0.000164617971265    1.000000000000000    0.000016898379558
         8           10    3.847766984666372    0.000166429006220    1.000000000000000    0.000012443999735
         9           11    3.847766983362412    0.000283352274089    1.000000000000000    0.000020703988665
        10           12    3.847766981213582    0.000553403922664    1.000000000000000    0.000028449298391
        11           13    3.847766978099789    0.000894432647400    1.000000000000000    0.000024529091561
        12           15    3.847766977026541    0.000453665329957    0.365052732160315    0.000033119051065
        13           16    3.847766974825598    0.000680058683720    1.000000000000000    0.000014148229130
        14           17    3.847766973774829    0.000291713727149    1.000000000000000    0.000010261515827
        15           18    3.847766972970124    0.000279864259918    1.000000000000000    0.000011363034807
        16           19    3.847766972896235    0.000339347313945    1.000000000000000    0.000026479406672
        17           20    3.847766972194905    0.000049285027305    1.000000000000000    0.000008306010120
        18           21    3.847766971945239    0.000066724392838    1.000000000000000    0.000006218787876
        19           22    3.847766971547328    0.000192154546658    1.000000000000000    0.000011037346709
        20           23    3.847766971041266    0.000284571478652    1.000000000000000    0.000013696485315
        21           24    3.847766970096536    0.000492069072026    1.000000000000000    0.000011260645498
        22           25    3.847766969131647    0.000630149031010    1.000000000000000    0.000006768173125
        23           26    3.847766968690171    0.000562886238417    1.000000000000000    0.000017043293166
        24           27    3.847766968212910    0.000157463943425    1.000000000000000    0.000007169673061
        25           28    3.847766967981236    0.000099816385889    1.000000000000000    0.000005919362734
        26           29    3.847766967676808    0.000201704542601    1.000000000000000    0.000004941375338
        27           30    3.847766967354549    0.000295380957920    1.000000000000000    0.000003884353754
        28           31    3.847766967025343    0.000348578028204    1.000000000000000    0.000002985533604
        29           33    3.847766966981059    0.000080202914613    0.239971561172214    0.000005885098316
        30           34    3.847766966860764    0.000180823170882    1.000000000000000    0.000003115060980
        31           35    3.847766966779477    0.000085798303193    1.000000000000000    0.000002297067040
        32           36    3.847766966618466    0.000218649566472    1.000000000000000    0.000002242926727
        33           37    3.847766966531283    0.000146480792299    1.000000000000000    0.000001785986763
        34           38    3.847766966420333    0.000227074913911    1.000000000000000    0.000001649035847
        35           39    3.847766966335904    0.000278676872682    1.000000000000000    0.000002194335960
        36           40    3.847766966251997    0.000137654618217    1.000000000000000    0.000001671011897
        37           41    3.847766966137526    0.000239416397412    1.000000000000000    0.000001662213937
        38           42    3.847766966042067    0.000267241886661    1.000000000000000    0.000001296950646
        39           43    3.847766965955948    0.000267241886661    1.000000000000000    0.000001096457429
Convergence criteria met.
After: gradient norm = 1.0964574291573373E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0964,-0.0964}

Count Table 1:
---------------
h:                 {0.0664,-0.0664}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {0.2454,-0.2454}

Count Table 5:
---------------
h:                 {0.3178,-0.3178}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-1.2169,-2.2915,-0.6862,-0.8692,-1.1946,-1.2980,0.2640,-1.2355,-0.8270,-2.4023,-2.1611,-1.1946,-2.0816,-2.2819,-3.8245,2.2808,0.4728,-2.1611,-3.3119,-3.4388,-0.0281,0.5766,-1.8662,0.4728,1.3720,-3.2847,0.0084,-0.7967,-3.0284,-1.8662,-2.7364,0.9962,-2.9175,-0.1675,0.2580,-3.0284,-0.1675,-2.9175,0.9962,-2.7364,-3.0284,0.2580,-0.7967,0.0084,-3.2847,1.3720,-1.8662,-3.0284,0.5766,-0.0281,-3.4388,-3.3119,0.4728,-1.8662,2.2808,-3.8245,-2.2819,-2.0816,-2.1611,0.4728,-2.4023,-0.8270,-1.2355,0.2640,-1.1946,-2.1611,-0.8692,-0.6862,-2.2915,-1.2169,-1.2980,-1.1946}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0443,-2.7836}
Activity(exp=1):   {0.0443,-2.9534}
Activity(exp=2):   {0.0443,0.0443}
Activity(exp=3):   {0.0443,0.0443}
Activity(exp=4):   {0.0443,-1.2396}
Activity(exp=5):   {0.0443,-0.8232}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;7;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component1-2-variation4).
>>  Starting new optimization: component1-2-variation4. (2021-05-21 17:41:23.514).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 3.8477666806811257
gradient      = {0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 5.841832246592671E-6
Starting Function Value: 3.8477666806811257
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.847766680640341    0.000013704303338    2.345891281898323    0.000002878364846
         2            4    3.847766680628487    0.000006304732957    1.000000000000000    0.000001634829182
         3            5    3.847766680617626    0.000009935577705    1.000000000000000    0.000001430269005
         4            6    3.847766680605398    0.000015312730860    1.000000000000000    0.000001935381427
         5            7    3.847766680582952    0.000037170358728    1.000000000000000    0.000002301322096
         6            9    3.847766680571793    0.000027223365792    0.488141129725572    0.000002698298642
         7           10    3.847766680558531    0.000020457417696    1.000000000000000    0.000001591188646
         8           11    3.847766680542025    0.000030213086485    1.000000000000000    0.000001740293838
         9           12    3.847766680524199    0.000038539715532    1.000000000000000    0.000002692942884
        10           13    3.847766680490089    0.000086651534896    1.000000000000000    0.000003467964510
        11           15    3.847766680475631    0.000055195101014    0.394887929128995    0.000004035242514
        12           16    3.847766680448802    0.000069001489549    1.000000000000000    0.000002175538872
        13           17    3.847766680433419    0.000069001489549    1.000000000000000    0.000001161209990
Convergence criteria met.
After: gradient norm = 1.161209990010653E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0964,-0.0964}

Count Table 1:
---------------
h:                 {0.0664,-0.0664}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {0.2454,-0.2454}

Count Table 5:
---------------
h:                 {0.3179,-0.3179}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-1.2169,-2.2915,-0.6862,-0.8692,-1.1946,-1.2981,0.2640,-1.2354,-0.8270,-2.4023,-2.1611,-1.1946,-2.0817,-2.2818,-3.8244,2.2808,0.4728,-2.1611,-3.3119,-3.4386,-0.0281,0.5765,-1.8661,0.4728,1.3720,-3.2848,0.0085,-0.7966,-3.0284,-1.8661,-2.7364,0.9962,-2.9173,-0.1675,0.2580,-3.0284,-0.1675,-2.9173,0.9962,-2.7364,-3.0284,0.2580,-0.7966,0.0085,-3.2848,1.3720,-1.8661,-3.0284,0.5765,-0.0281,-3.4386,-3.3119,0.4728,-1.8661,2.2808,-3.8244,-2.2818,-2.0817,-2.1611,0.4728,-2.4023,-0.8270,-1.2354,0.2640,-1.1946,-2.1611,-0.8692,-0.6862,-2.2915,-1.2169,-1.2981,-1.1946}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0443,-2.7836}
Activity(exp=1):   {0.0443,-2.9534}
Activity(exp=2):   {0.0443,0.0443}
Activity(exp=3):   {0.0443,0.0443}
Activity(exp=4):   {0.0443,-1.2395}
Activity(exp=5):   {0.0443,-0.8231}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;8;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component1-2-variation5).
>>  Starting new optimization: component1-2-variation5. (2021-05-21 17:41:40.052).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 3.8477666778072384
gradient      = {-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000}
gradient norm = 1.1663017227471854E-6
Already at minimum!
After: gradient norm = 1.1663017227471854E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0964,-0.0964}

Count Table 1:
---------------
h:                 {0.0664,-0.0664}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {0.2454,-0.2454}

Count Table 5:
---------------
h:                 {0.3179,-0.3179}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-1.2169,-2.2915,-0.6862,-0.8692,-1.1946,-1.2981,0.2640,-1.2354,-0.8270,-2.4023,-2.1611,-1.1946,-2.0817,-2.2818,-3.8244,2.2808,0.4728,-2.1611,-3.3119,-3.4386,-0.0281,0.5765,-1.8661,0.4728,1.3720,-3.2848,0.0085,-0.7966,-3.0284,-1.8661,-2.7364,0.9962,-2.9173,-0.1675,0.2580,-3.0284,-0.1675,-2.9173,0.9962,-2.7364,-3.0284,0.2580,-0.7966,0.0085,-3.2848,1.3720,-1.8661,-3.0284,0.5765,-0.0281,-3.4386,-3.3119,0.4728,-1.8661,2.2808,-3.8244,-2.2818,-2.0817,-2.1611,0.4728,-2.4023,-0.8270,-1.2354,0.2640,-1.1946,-2.1611,-0.8692,-0.6862,-2.2915,-1.2169,-1.2981,-1.1946}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0443,-2.7836}
Activity(exp=1):   {0.0443,-2.9534}
Activity(exp=2):   {0.0443,0.0443}
Activity(exp=3):   {0.0443,0.0443}
Activity(exp=4):   {0.0443,-1.2395}
Activity(exp=5):   {0.0443,-0.8231}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;9;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component1-2-variation6).
>>  Starting new optimization: component1-2-variation6. (2021-05-21 17:41:41.144).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 3.8477666769878462
gradient      = {-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000}
gradient norm = 1.1664032257313063E-6
Already at minimum!
After: gradient norm = 1.1664032257313063E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0964,-0.0964}

Count Table 1:
---------------
h:                 {0.0664,-0.0664}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {0.2454,-0.2454}

Count Table 5:
---------------
h:                 {0.3179,-0.3179}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-1.2169,-2.2915,-0.6862,-0.8692,-1.1946,-1.2981,0.2640,-1.2354,-0.8270,-2.4023,-2.1611,-1.1946,-2.0817,-2.2818,-3.8244,2.2808,0.4728,-2.1611,-3.3119,-3.4386,-0.0281,0.5765,-1.8661,0.4728,1.3720,-3.2848,0.0085,-0.7966,-3.0284,-1.8661,-2.7364,0.9962,-2.9173,-0.1675,0.2580,-3.0284,-0.1675,-2.9173,0.9962,-2.7364,-3.0284,0.2580,-0.7966,0.0085,-3.2848,1.3720,-1.8661,-3.0284,0.5765,-0.0281,-3.4386,-3.3119,0.4728,-1.8661,2.2808,-3.8244,-2.2818,-2.0817,-2.1611,0.4728,-2.4023,-0.8270,-1.2354,0.2640,-1.1946,-2.1611,-0.8692,-0.6862,-2.2915,-1.2169,-1.2981,-1.1946}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0443,-2.7836}
Activity(exp=1):   {0.0443,-2.9534}
Activity(exp=2):   {0.0443,0.0443}
Activity(exp=3):   {0.0443,0.0443}
Activity(exp=4):   {0.0443,-1.2395}
Activity(exp=5):   {0.0443,-0.8231}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;10;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component1-2-variation7).
>>  Starting new optimization: component1-2-variation7. (2021-05-21 17:41:42.356).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 3.8477666779765523
gradient      = {-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 1.1721429259072175E-6
Already at minimum!
After: gradient norm = 1.1721429259072175E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0964,-0.0964}

Count Table 1:
---------------
h:                 {0.0664,-0.0664}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {0.2454,-0.2454}

Count Table 5:
---------------
h:                 {0.3179,-0.3179}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-1.2169,-2.2915,-0.6862,-0.8692,-1.1946,-1.2981,0.2640,-1.2354,-0.8270,-2.4023,-2.1611,-1.1946,-2.0817,-2.2818,-3.8244,2.2808,0.4728,-2.1611,-3.3119,-3.4386,-0.0281,0.5765,-1.8661,0.4728,1.3720,-3.2848,0.0085,-0.7966,-3.0284,-1.8661,-2.7364,0.9962,-2.9173,-0.1675,0.2580,-3.0284,-0.1675,-2.9173,0.9962,-2.7364,-3.0284,0.2580,-0.7966,0.0085,-3.2848,1.3720,-1.8661,-3.0284,0.5765,-0.0281,-3.4386,-3.3119,0.4728,-1.8661,2.2808,-3.8244,-2.2818,-2.0817,-2.1611,0.4728,-2.4023,-0.8270,-1.2354,0.2640,-1.1946,-2.1611,-0.8692,-0.6862,-2.2915,-1.2169,-1.2981,-1.1946}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0443,-2.7836}
Activity(exp=1):   {0.0443,-2.9534}
Activity(exp=2):   {0.0443,0.0443}
Activity(exp=3):   {0.0443,0.0443}
Activity(exp=4):   {0.0443,-1.2395}
Activity(exp=5):   {0.0443,-0.8231}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID NOT improve. Discarding fit component1-2-variation7.
> No varitions possible for Binding mode 1.
> Unfreezing component (component1-3-f0).
>>  Starting new optimization: component1-3-f0. (2021-05-21 17:41:43.639).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[249,250]},{"h":[251,252]},{"h":[253,254]},{"h":[255,256]},{"h":[257,258]},{"h":[259,260]}],"bindingModeInteractions":[],"bindingModes":[{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[237,238],[239,240],[241,242],[243,244],[245,246],[247,248]],"dinucleotide":[[43,42,47,46,44,45,37,36,41,40,38,39,67,66,71,70,68,69,61,60,65,64,62,63,49,48,53,52,50,51,55,54,59,58,56,57,79,78,83,82,80,81,73,72,77,76,74,75,103,102,107,106,104,105,97,96,101,100,98,99,85,84,89,88,86,87,91,90,95,94,92,93,115,114,119,118,116,117,109,108,113,112,110,111,139,138,143,142,140,141,133,132,137,136,134,135,121,120,125,124,122,123,127,126,131,130,128,129,151,150,155,154,152,153,145,144,149,148,146,147,175,174,179,178,176,177,169,168,173,172,170,171,157,156,161,160,158,159,163,162,167,166,164,165,187,186,191,190,188,189,181,180,185,184,182,183,211,210,215,214,212,213,205,204,209,208,206,207,193,192,197,196,194,195,199,198,203,202,200,201,223,222,220,226,224,225,217,216,221,220,218,219,234,236,216,222,231,227,235,234,217,223,232,228,228,227,219,225,229,230,232,231,218,224,233,229,208,214,184,190,202,196,209,215,185,191,203,197,204,210,180,186,198,192,205,211,181,187,199,193,207,213,183,189,201,195,206,212,182,188,200,194,172,178,148,154,166,160,173,179,149,155,167,161,168,174,144,150,162,156,169,175,145,151,163,157,171,177,147,153,165,159,170,176,146,152,164,158,136,142,112,118,130,124,137,143,113,119,131,125,132,138,108,114,126,120,133,139,109,115,127,121,135,141,111,117,129,123,134,140,110,116,128,122,100,106,76,82,94,88,101,107,77,83,95,89,96,102,72,78,90,84,97,103,73,79,91,85,99,105,75,81,93,87,98,104,74,80,92,86,64,70,40,46,58,52,65,71,41,47,59,53,60,66,36,42,54,48,61,67,37,43,55,49,63,69,39,45,57,51,62,68,38,44,56,50]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 3.8477666769878476
gradient      = {-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0041,-0.0028,0.0000,0.0000,-0.0003,-0.0011,-0.0001,0.0011,0.0000,0.0000,0.0001,-0.0011,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0001,-0.0012,0.0007,0.0000,0.0000,0.0005,-0.0000,-0.0028,0.0010,-0.0000,0.0000,-0.0003,0.0021,-0.0001,-0.0002,-0.0001,0.0000,0.0005,-0.0000,0.0002,0.0002,0.0004,0.0000,-0.0009,0.0001,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0001,0.0000,-0.0001,0.0000,-0.0001,-0.0001,-0.0001,0.0000,0.0004,-0.0000,0.0000,0.0002,-0.0003,0.0000,0.0001,0.0000,-0.0001,-0.0000,-0.0000,0.0000,0.0002,-0.0000,-0.0001,-0.0000,-0.0000,0.0000,0.0000,0.0002,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0003,0.0001,0.0000,0.0000,-0.0001,-0.0003,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0001,-0.0000,0.0001,0.0000,0.0000,-0.0001,0.0000,-0.0000,0.0003,-0.0000,0.0000,-0.0002,-0.0001,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0001,-0.0014,0.0000,0.0000,0.0003,0.0012,0.0004,0.0126,0.0000,0.0000,-0.0003,-0.0127,-0.0002,-0.0116,0.0000,0.0000,0.0003,0.0115,0.0003,-0.0001,0.0000,0.0000,-0.0003,-0.0000,0.0039,0.0006,0.0013,0.0000,-0.0059,0.0001,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0009,-0.0001,-0.0002,0.0000,0.0011,0.0000,-0.0033,-0.0005,-0.0011,0.0000,0.0051,-0.0002,0.0004,-0.0025,0.0000,0.0000,0.0004,0.0009,-0.0001,-0.0002,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0001,0.0013,-0.0002,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000}
gradient norm = 0.027223577232811092
Starting Function Value: 3.8477666769878476
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            2    3.830872089024476    1.000000000000000   36.732865466142876    0.027816281471256
         2            4    3.829095807572138    0.203715949848590    0.139747475421229    0.028352844163290
         3            5    3.826648244038339    0.422051247555973    1.000000000000000    0.013334917626701
         4            6    3.825520549809420    0.261269796286730    1.000000000000000    0.009427001832433
         5            7    3.824746443539233    0.296787534883324    1.000000000000000    0.010312853924542
         6            8    3.824238551888270    0.154965284292096    1.000000000000000    0.012627255220418
         7            9    3.823820084949485    0.108462233317730    1.000000000000000    0.007324815041844
         8           10    3.823458380737721    0.131110915748377    1.000000000000000    0.005345120844008
         9           11    3.823166219272177    0.175690312313218    1.000000000000000    0.010585702488744
        10           12    3.822856804355715    0.163194400324176    1.000000000000000    0.005234589561378
        11           13    3.822698905425758    0.109671624947953    1.000000000000000    0.004356815387502
        12           14    3.822540645663529    0.173424853971424    1.000000000000000    0.008772754346865
        13           15    3.822340354301588    0.101720609534220    1.000000000000000    0.004447022661141
        14           16    3.822176158019208    0.106927519625818    1.000000000000000    0.004441816481110
        15           17    3.821982400375338    0.149820628036851    1.000000000000000    0.004318607221088
        16           18    3.821769906728677    0.256948983612337    1.000000000000000    0.011185895276408
        17           19    3.821478833790117    0.245059594312291    1.000000000000000    0.004856645407153
        18           20    3.821291670049720    0.169121422284009    1.000000000000000    0.003654717543781
        19           21    3.821123079262831    0.184684500673120    1.000000000000000    0.003251069489385
        20           22    3.820861150691048    0.276030393534413    1.000000000000000    0.003132812264782
        21           23    3.820368991087661    0.606470130695773    1.000000000000000    0.004592369092991
        22           25    3.820262801619664    0.197262020774449    0.145900652488363    0.007432437695636
        23           26    3.819882299915103    0.520524291205946    1.000000000000000    0.004343534267919
        24           27    3.819569301148822    0.347939350572448    1.000000000000000    0.003770552701368
        25           28    3.819028652763576    0.596134508038308    1.000000000000000    0.004694882627586
        26           29    3.818195823607486    0.980195111043174    1.000000000000000    0.006494119626843
        27           30    3.817324477031838    0.879073401372345    1.000000000000000    0.008401347186681
        28           31    3.816669846386175    0.573278007789016    1.000000000000000    0.011420524533523
        29           32    3.816243526275238    0.254916462700333    1.000000000000000    0.003600164139078
        30           33    3.816149242792415    0.170348930762241    1.000000000000000    0.003025836152866
        31           34    3.815977837906619    0.169844811332733    1.000000000000000    0.003393117055216
        32           35    3.815570707331997    0.386480636531343    1.000000000000000    0.004138269122158
        33           36    3.815180160044789    0.457040544671976    1.000000000000000    0.003558715494451
        34           37    3.815006067170724    0.453661394406775    1.000000000000000    0.003899534209853
        35           38    3.814829244703723    0.093055616463290    1.000000000000000    0.002023583924308
        36           39    3.814694033013207    0.150336174953713    1.000000000000000    0.002103715058867
        37           40    3.814493730143684    0.301842365842562    1.000000000000000    0.002750760120988
        38           41    3.814184394685327    0.571154578014287    1.000000000000000    0.003195954168086
        39           42    3.814051310283274    0.679496722379796    1.000000000000000    0.005294351327906
        40           43    3.813705332808507    0.259077394265716    1.000000000000000    0.002308447668875
        41           44    3.813519709078663    0.186591318180494    1.000000000000000    0.002059329087225
        42           45    3.813348115060673    0.275101216302964    1.000000000000000    0.002332626616874
        43           46    3.813047697253926    0.571370254640540    1.000000000000000    0.002637649037052
        44           47    3.812900175411194    0.469514335578047    1.000000000000000    0.001827429275108
        45           48    3.812778784237927    0.274141785168377    1.000000000000000    0.001304143037433
        46           49    3.812717070145389    0.117764473868978    1.000000000000000    0.001378504745274
        47           50    3.812668256622293    0.169553591478209    1.000000000000000    0.001007660644881
        48           51    3.812608873848429    0.215297867556122    1.000000000000000    0.001039420729918
        49           52    3.812536193832789    0.444420400533457    1.000000000000000    0.001676353760083
        50           53    3.812493747386228    0.140713301356105    1.000000000000000    0.000848350225738
        51           54    3.812463575290890    0.120885069489813    1.000000000000000    0.000772964084919
        52           55    3.812429607525260    0.138948703015020    1.000000000000000    0.000966284334152
        53           56    3.812371806648993    0.262831693537338    1.000000000000000    0.001034536410073
        54           57    3.812291576618938    0.397752260615895    1.000000000000000    0.000948681462786
        55           58    3.812214836536996    0.475717916014881    1.000000000000000    0.001003583017293
        56           59    3.812171136030615    0.212018815402109    1.000000000000000    0.000925423570388
        57           60    3.812143253837669    0.102887303947446    1.000000000000000    0.000820508263550
        58           61    3.812105871554790    0.160050272898583    1.000000000000000    0.000665152015325
        59           62    3.812059997287872    0.244477387878831    1.000000000000000    0.000673179031505
        60           63    3.812014283591484    0.278565239902939    1.000000000000000    0.000968675474041
        61           64    3.811965079290465    0.309952670921744    1.000000000000000    0.000813841170750
        62           65    3.811913189470912    0.283706636751843    1.000000000000000    0.001021161639612
        63           66    3.811874476269378    0.280287443690708    1.000000000000000    0.000631573886791
        64           67    3.811863506805486    0.068262386790372    1.000000000000000    0.000388406746640
        65           68    3.811855263310576    0.088598362539339    1.000000000000000    0.000463438408229
        66           69    3.811843702098530    0.091683903639998    1.000000000000000    0.000379271524251
        67           70    3.811828118715500    0.139363046052083    1.000000000000000    0.000407048305452
        68           71    3.811806782722385    0.203758316959376    1.000000000000000    0.000404802523485
        69           72    3.811800814405160    0.248689931147940    1.000000000000000    0.000965323836367
        70           73    3.811787033340855    0.053751180670874    1.000000000000000    0.000259892030989
        71           74    3.811783293409773    0.027872634874629    1.000000000000000    0.000221906119695
        72           75    3.811778515131523    0.057501749653426    1.000000000000000    0.000272523160719
        73           76    3.811772023346767    0.091156218666612    1.000000000000000    0.000238707386228
        74           77    3.811761490413713    0.172563205439443    1.000000000000000    0.000211117747228
        75           78    3.811752743962686    0.221408666734601    1.000000000000000    0.000341460676094
        76           79    3.811745873413613    0.137682226667098    1.000000000000000    0.000247324424661
        77           80    3.811739506094631    0.118345908164312    1.000000000000000    0.000222288759025
        78           81    3.811732341709922    0.142363266422685    1.000000000000000    0.000215999468854
        79           82    3.811723891994801    0.187834649209251    1.000000000000000    0.000330572379139
        80           83    3.811715515925842    0.194614110335629    1.000000000000000    0.000247209766481
        81           84    3.811708624217501    0.141019111071863    1.000000000000000    0.000226933514441
        82           85    3.811699489892464    0.184741546991327    1.000000000000000    0.000285253730503
        83           86    3.811690763149097    0.232367155781459    1.000000000000000    0.000256228711255
        84           87    3.811684921316192    0.096399570466252    1.000000000000000    0.000187823840044
        85           88    3.811680076642600    0.092226488225365    1.000000000000000    0.000172844716518
        86           89    3.811674792563991    0.122119610876450    1.000000000000000    0.000185685418622
        87           90    3.811670832772688    0.148302365453992    1.000000000000000    0.000194255316658
        88           91    3.811669193951965    0.070553425254809    1.000000000000000    0.000125067197379
        89           92    3.811667651549416    0.063789166738681    1.000000000000000    0.000123390600892
        90           93    3.811665274655275    0.092704004224695    1.000000000000000    0.000147344362544
        91           94    3.811663327739055    0.100095255006112    1.000000000000000    0.000116416592018
        92           95    3.811662531112381    0.036885755047172    1.000000000000000    0.000074186671376
        93           96    3.811661908327112    0.030322944202609    1.000000000000000    0.000084735632182
        94           97    3.811660671568076    0.053703303303710    1.000000000000000    0.000114083597848
        95           98    3.811659024891589    0.111279034777847    1.000000000000000    0.000092908222614
        96           99    3.811657933988050    0.073354067698357    1.000000000000000    0.000094206687871
        97          100    3.811657160645007    0.058125153301365    1.000000000000000    0.000068193520610
        98          101    3.811656374921866    0.042331056127746    1.000000000000000    0.000083617173270
        99          102    3.811655266617933    0.071379583373945    1.000000000000000    0.000091033367993
       100          103    3.811653482077082    0.115486013437442    1.000000000000000    0.000152580659226
       101          104    3.811651140586044    0.177639917911952    1.000000000000000    0.000114295988091
       102          105    3.811649029270216    0.145404383224928    1.000000000000000    0.000102663591395
       103          107    3.811648462340355    0.058259080177114    0.308208003615822    0.000647757797191
       104          108    3.811646825494207    0.120670478555677    1.000000000000000    0.000274417356420
       105          109    3.811646054266525    0.036891283737859    1.000000000000000    0.000137196186931
       106          110    3.811645159321651    0.058352021008693    1.000000000000000    0.000134685042622
       107          112    3.811644951820977    0.023879917936869    0.481745049400117    0.000281784507164
       108          113    3.811644538480282    0.030151890160871    1.000000000000000    0.000151657630291
       109          114    3.811644069324811    0.040866316469997    1.000000000000000    0.000099178100390
       110          115    3.811643657504708    0.038626796954422    1.000000000000000    0.000113708074295
       111          116    3.811643110703330    0.051419511032042    1.000000000000000    0.000270256391387
       112          117    3.811642488499355    0.074518989869417    1.000000000000000    0.000224324957877
       113          118    3.811641894045438    0.019107689175528    1.000000000000000    0.000153809747179
       114          119    3.811641005732758    0.046919519686130    1.000000000000000    0.000239612152073
       115          121    3.811640822174041    0.024494043334324    0.460625866253688    0.000304068244276
       116          122    3.811640550058203    0.032697635494588    1.000000000000000    0.000160500657571
       117          123    3.811640317587179    0.036201000457214    1.000000000000000    0.000105733490763
       118          124    3.811640074423170    0.031598005727257    1.000000000000000    0.000161263598407
       119          125    3.811639504398639    0.064826098692495    1.000000000000000    0.000285425683738
       120          127    3.811639250189411    0.037400174514217    0.326961438236730    0.000430556647863
       121          128    3.811638642712300    0.046561699965345    1.000000000000000    0.000273987036974
       122          129    3.811638132310618    0.027288577491841    1.000000000000000    0.000135835797722
       123          130    3.811637838596425    0.011817105265424    1.000000000000000    0.000128942908159
       124          131    3.811637459965968    0.018643615992629    1.000000000000000    0.000203969342534
       125          133    3.811637241444597    0.022901685869424    0.442502830233183    0.000375482024741
       126          134    3.811636842935850    0.033776543697598    1.000000000000000    0.000237959579118
       127          135    3.811636434164975    0.054673777264046    1.000000000000000    0.000150588053507
       128          136    3.811636090224237    0.050214845271473    1.000000000000000    0.000160809802847
       129          137    3.811635495597235    0.077471463245350    1.000000000000000    0.000238770555307
       130          138    3.811634644354270    0.097880004851106    1.000000000000000    0.000289803782381
       131          139    3.811633736331767    0.105647425006072    1.000000000000000    0.000326646424034
       132          140    3.811633592492633    0.090029476047463    1.000000000000000    0.000530781251032
       133          141    3.811632952280521    0.051159990766462    1.000000000000000    0.000099767801758
       134          142    3.811632825465777    0.016871798075873    1.000000000000000    0.000119635582565
       135          143    3.811632571484165    0.009436163838385    1.000000000000000    0.000165939882276
       136          144    3.811632128331791    0.032003420044331    1.000000000000000    0.000167297363588
       137          145    3.811631033473658    0.119855961747847    1.000000000000000    0.000237713047060
       138          146    3.811630541106021    0.242402048357282    1.000000000000000    0.000468754962949
       139          147    3.811629434976244    0.018150117782235    1.000000000000000    0.000118459066240
       140          148    3.811629059410258    0.023771805783181    1.000000000000000    0.000102063717206
       141          149    3.811628673913085    0.041170465272797    1.000000000000000    0.000115371781291
       142          150    3.811627979090040    0.069599719809693    1.000000000000000    0.000110404806335
       143          152    3.811627632900591    0.061132577374071    0.438814664013800    0.000165498729310
       144          153    3.811627112966781    0.047635980040098    1.000000000000000    0.000086497302091
       145          154    3.811626797787665    0.035829675752684    1.000000000000000    0.000103898836922
       146          155    3.811626299872083    0.038073827517230    1.000000000000000    0.000139052720332
       147          156    3.811625371068785    0.099534503574508    1.000000000000000    0.000201478073493
       148          157    3.811624078755352    0.174589636030146    1.000000000000000    0.000215623460189
       149          158    3.811623003389059    0.146804269184195    1.000000000000000    0.000159022748685
       150          159    3.811622280689356    0.037521991752132    1.000000000000000    0.000118026977275
       151          160    3.811621675008447    0.046836612262825    1.000000000000000    0.000140023689428
       152          161    3.811621102946462    0.056371736330292    1.000000000000000    0.000165332716711
       153          162    3.811620385311035    0.082649621264059    1.000000000000000    0.000137888258779
       154          163    3.811619303483897    0.167209467649031    1.000000000000000    0.000227034056191
       155          164    3.811618463450059    0.109210388076893    1.000000000000000    0.000175016107844
       156          165    3.811617826799023    0.039044548333807    1.000000000000000    0.000141415861162
       157          166    3.811616798828210    0.089532246129265    1.000000000000000    0.000095553124968
       158          167    3.811616330902921    0.066379504388688    1.000000000000000    0.000196382810839
       159          168    3.811615841725331    0.052218116385276    1.000000000000000    0.000123068957228
       160          169    3.811615232984404    0.072755732844261    1.000000000000000    0.000085515179925
       161          170    3.811614839298397    0.052278934288302    1.000000000000000    0.000092207256754
       162          171    3.811614189028650    0.090694763862796    1.000000000000000    0.000099814007749
       163          172    3.811613757327913    0.120792072805995    1.000000000000000    0.000187831060925
       164          173    3.811613244211165    0.010808823499776    1.000000000000000    0.000079578492374
       165          174    3.811612857616443    0.016642208713826    1.000000000000000    0.000083634568984
       166          175    3.811612533764963    0.029095218181632    1.000000000000000    0.000106455385367
       167          176    3.811611909835559    0.102793948594417    1.000000000000000    0.000151155016075
       168          177    3.811611489712931    0.104488983846663    1.000000000000000    0.000155331458283
       169          178    3.811611198270505    0.012689213591247    1.000000000000000    0.000067440218298
       170          179    3.811610983133645    0.024054452970497    1.000000000000000    0.000082013053276
       171          180    3.811610799167829    0.021531582514259    1.000000000000000    0.000095296334501
       172          181    3.811610052825426    0.092932479801630    1.000000000000000    0.000120300022412
       173          182    3.811609825450832    0.115917094941964    1.000000000000000    0.000209285947130
       174          183    3.811609157404392    0.042629780721779    1.000000000000000    0.000066900968306
       175          184    3.811608949870578    0.011255929293915    1.000000000000000    0.000046398763286
       176          185    3.811608672082402    0.033068311758916    1.000000000000000    0.000057758204159
       177          186    3.811608291970631    0.061183054212562    1.000000000000000    0.000106361759572
       178          187    3.811607903085896    0.057083894160559    1.000000000000000    0.000074789676065
       179          188    3.811607492260748    0.069753844346744    1.000000000000000    0.000052645108057
       180          189    3.811607149975453    0.050512880107459    1.000000000000000    0.000062809215286
       181          190    3.811606874703938    0.062158611287811    1.000000000000000    0.000074120090294
       182          191    3.811606678041069    0.015607017306183    1.000000000000000    0.000048652796523
       183          192    3.811606412912888    0.025371387040705    1.000000000000000    0.000059594512509
       184          193    3.811606119054474    0.031871915459142    1.000000000000000    0.000074285503537
       185          194    3.811605677955603    0.104109667685188    1.000000000000000    0.000145386175389
       186          195    3.811605207672448    0.054333204677497    1.000000000000000    0.000080258101769
       187          196    3.811604848391614    0.061120918678366    1.000000000000000    0.000044547855758
       188          197    3.811604659830343    0.031346847066129    1.000000000000000    0.000045358526013
       189          198    3.811604432522782    0.044438718446388    1.000000000000000    0.000060476581211
       190          199    3.811604201054996    0.053914877399198    1.000000000000000    0.000062572662267
       191          200    3.811603976252540    0.024992920859825    1.000000000000000    0.000046275969745
       192          201    3.811603611559914    0.052467170195226    1.000000000000000    0.000066470759328
       193          202    3.811603461051170    0.039158632402438    1.000000000000000    0.000064632168961
       194          203    3.811603345988222    0.014255655600355    1.000000000000000    0.000036994667353
       195          204    3.811603239644517    0.020616860220344    1.000000000000000    0.000028760854500
       196          205    3.811603162493716    0.011861110261819    1.000000000000000    0.000031300721084
       197          206    3.811602950567533    0.039132883819302    1.000000000000000    0.000031669360865
       198          207    3.811602818375120    0.039790021224151    1.000000000000000    0.000072317923273
       199          208    3.811602642015987    0.036134422528826    1.000000000000000    0.000030011933783
       200          209    3.811602552451333    0.013672396036991    1.000000000000000    0.000021522815815
       201          210    3.811602471073497    0.017661410218711    1.000000000000000    0.000025158767883
       202          211    3.811602423333434    0.024915064252115    1.000000000000000    0.000044319571755
       203          212    3.811602357273350    0.007454626000955    1.000000000000000    0.000019478219023
       204          213    3.811602307329298    0.011135660105701    1.000000000000000    0.000028627386248
       205          215    3.811602301893852    0.003586267855732    0.127934612710549    0.000049975305375
       206          216    3.811602277186273    0.010268865596925    1.000000000000000    0.000026389550889
       207          217    3.811602257621990    0.006884937862758    1.000000000000000    0.000024489356993
       208          218    3.811602229031553    0.008421919629865    1.000000000000000    0.000028282783717
       209          220    3.811602222182601    0.003173489252538    0.234165033025571    0.000059022717897
       210          221    3.811602199731582    0.005750584065780    1.000000000000000    0.000031626647690
       211          222    3.811602182163732    0.003712930351512    1.000000000000000    0.000019546281077
       212          223    3.811602164872767    0.004597979417082    1.000000000000000    0.000020650110948
       213          224    3.811602147017202    0.005130849933633    1.000000000000000    0.000019667030726
       214          226    3.811602141345737    0.004167844051231    0.180945002374963    0.000055735277695
       215          227    3.811602118636876    0.008981021336952    1.000000000000000    0.000028730592161
       216          228    3.811602101509767    0.005965828931778    1.000000000000000    0.000021003109353
       217          229    3.811602089957852    0.008473287842669    1.000000000000000    0.000074089994456
       218          230    3.811602075962266    0.005662924195047    1.000000000000000    0.000033675668406
       219          231    3.811602070967764    0.002366183332425    1.000000000000000    0.000020253547145
       220          232    3.811602063413355    0.002365802851557    1.000000000000000    0.000017806621860
       221          233    3.811602054129724    0.002745009957172    1.000000000000000    0.000027617185742
       222          234    3.811602037714955    0.006209276406022    1.000000000000000    0.000038354035280
       223          236    3.811602031927030    0.003833120501297    0.213270460422518    0.000059623759151
       224          237    3.811602017513113    0.006976932223627    1.000000000000000    0.000032066159341
       225          238    3.811602004728968    0.006960113124630    1.000000000000000    0.000024260241223
       226          239    3.811601993466148    0.005180187581334    1.000000000000000    0.000031062650858
       227          240    3.811601980032020    0.006534671244930    1.000000000000000    0.000066677583614
       228          241    3.811601966995383    0.007374525831745    1.000000000000000    0.000054919230192
       229          242    3.811601955978603    0.002225550669087    1.000000000000000    0.000028726349712
       230          243    3.811601943606321    0.003307901980491    1.000000000000000    0.000027578222585
       231          244    3.811601936058511    0.002744041504400    1.000000000000000    0.000028438355781
       232          245    3.811601912625773    0.013185805105617    1.000000000000000    0.000034251667807
       233          246    3.811601897453040    0.014624630042763    1.000000000000000    0.000046729693475
       234          247    3.811601882832353    0.007889525045901    1.000000000000000    0.000045609637255
       235          248    3.811601871143363    0.004541253029819    1.000000000000000    0.000034399603928
       236          249    3.811601858129393    0.004397652130901    1.000000000000000    0.000036459965058
       237          250    3.811601852014250    0.013521772826138    1.000000000000000    0.000098009763498
       238          251    3.811601834069694    0.005249942551093    1.000000000000000    0.000041054527443
       239          252    3.811601822112936    0.004754502988515    1.000000000000000    0.000019722803652
       240          253    3.811601812637141    0.005516070666781    1.000000000000000    0.000023106545814
       241          254    3.811601801172565    0.005664766073775    1.000000000000000    0.000023089459643
       242          256    3.811601791452692    0.006704273425388    0.398773313555589    0.000043297778223
       243          257    3.811601772521905    0.007988057423124    1.000000000000000    0.000028697296137
       244          258    3.811601753611182    0.007478696113321    1.000000000000000    0.000022079804194
       245          259    3.811601725118447    0.012657612743699    1.000000000000000    0.000021181578218
       246          260    3.811601696276473    0.012895197516620    1.000000000000000    0.000028649292405
       247          261    3.811601683369273    0.019250968400248    1.000000000000000    0.000050761598105
       248          262    3.811601653313402    0.005883157117385    1.000000000000000    0.000022330660475
       249          263    3.811601638304739    0.006717384696934    1.000000000000000    0.000017495499091
       250          264    3.811601617137680    0.012773712166014    1.000000000000000    0.000018323743990
       251          265    3.811601594171247    0.015756326548268    1.000000000000000    0.000021028573155
       252          266    3.811601582090671    0.021195434714055    1.000000000000000    0.000041081168502
       253          267    3.811601566845946    0.009860500649216    1.000000000000000    0.000022576440341
       254          268    3.811601559351463    0.005126493615821    1.000000000000000    0.000013691235390
       255          269    3.811601551105980    0.003698173287812    1.000000000000000    0.000009005309085
       256          270    3.811601542820713    0.006095108403633    1.000000000000000    0.000016653588293
       257          271    3.811601532470629    0.007381883177380    1.000000000000000    0.000021270823570
       258          272    3.811601521080918    0.011571717720928    1.000000000000000    0.000021689724640
       259          273    3.811601508180069    0.019406939467711    1.000000000000000    0.000026187508591
       260          274    3.811601496730534    0.002461493265835    1.000000000000000    0.000012239260037
       261          275    3.811601489041328    0.002895042444093    1.000000000000000    0.000015339667906
       262          276    3.811601481909741    0.002950577303944    1.000000000000000    0.000017181792171
       263          277    3.811601472868246    0.008340226058494    1.000000000000000    0.000033576525748
       264          278    3.811601461082356    0.009716569770039    1.000000000000000    0.000016518658915
       265          279    3.811601453926842    0.002011455344261    1.000000000000000    0.000010794687409
       266          280    3.811601443805167    0.004944040842297    1.000000000000000    0.000013032446844
       267          281    3.811601436207354    0.005294105018989    1.000000000000000    0.000013642612134
       268          282    3.811601434544011    0.016286149190820    1.000000000000000    0.000032159596303
       269          283    3.811601420490058    0.004735189733773    1.000000000000000    0.000009042655119
       270          284    3.811601416978226    0.001385081108676    1.000000000000000    0.000007801234917
       271          285    3.811601412034600    0.003548154574582    1.000000000000000    0.000022198398809
       272          286    3.811601407446481    0.003688041403204    1.000000000000000    0.000011952405451
       273          287    3.811601403793043    0.002591114820380    1.000000000000000    0.000009512922070
       274          288    3.811601395643145    0.007832701182033    1.000000000000000    0.000012092620624
       275          289    3.811601389904843    0.005333628131624    1.000000000000000    0.000014279406836
       276          290    3.811601379170819    0.012710201749182    1.000000000000000    0.000027781457853
       277          291    3.811601368287513    0.009100731692483    1.000000000000000    0.000011950866619
       278          292    3.811601362161682    0.002315358445807    1.000000000000000    0.000009436822401
       279          293    3.811601353750014    0.003779091002217    1.000000000000000    0.000013495227772
       280          294    3.811601345971010    0.005435415897281    1.000000000000000    0.000015012559522
       281          295    3.811601336870138    0.015274088004642    1.000000000000000    0.000018743983277
       282          296    3.811601324508932    0.006364089281290    1.000000000000000    0.000012267281204
       283          297    3.811601313835714    0.006173312009415    1.000000000000000    0.000012811399764
       284          298    3.811601301922716    0.010035109386228    1.000000000000000    0.000013715942868
       285          299    3.811601295026016    0.015777919482208    1.000000000000000    0.000032425022257
       286          300    3.811601279156053    0.008260247617778    1.000000000000000    0.000011795116949
       287          301    3.811601272571999    0.004317958354298    1.000000000000000    0.000008507519906
       288          302    3.811601265511345    0.006643768295870    1.000000000000000    0.000012383095248
       289          303    3.811601256610091    0.010551848811110    1.000000000000000    0.000015298377000
       290          304    3.811601246228826    0.020933979623713    1.000000000000000    0.000022879397582
       291          305    3.811601235646700    0.007011278731743    1.000000000000000    0.000009521416915
       292          306    3.811601228348044    0.005159892246084    1.000000000000000    0.000012767841118
       293          307    3.811601222444127    0.004227081894058    1.000000000000000    0.000013243102200
       294          308    3.811601209681429    0.010874988148414    1.000000000000000    0.000011634583517
       295          310    3.811601203549210    0.010488814291200    0.497061041161251    0.000020967573872
       296          311    3.811601194483047    0.008063254023089    1.000000000000000    0.000011645764827
       297          312    3.811601187665418    0.005639769500621    1.000000000000000    0.000010760198456
       298          313    3.811601179345982    0.007469491937263    1.000000000000000    0.000011674840439
       299          314    3.811601170393716    0.009187760637134    1.000000000000000    0.000012893040814
       300          316    3.811601165887971    0.007232510840649    0.467960562531541    0.000012588859463
       301          317    3.811601161934977    0.002906442767572    1.000000000000000    0.000006543740805
       302          318    3.811601159176786    0.002177178559084    1.000000000000000    0.000005622290480
       303          319    3.811601155751704    0.003019656160151    1.000000000000000    0.000006761605119
       304          320    3.811601149536561    0.006932479346141    1.000000000000000    0.000007602863645
       305          322    3.811601146170997    0.004830911627385    0.340724165779952    0.000014229126695
       306          323    3.811601140144755    0.007304171350600    1.000000000000000    0.000014317959621
       307          325    3.811601138686112    0.002910159847369    0.169802815150077    0.000022300543043
       308          326    3.811601135130351    0.004497697105151    1.000000000000000    0.000008794607640
       309          327    3.811601133484381    0.002168510952859    1.000000000000000    0.000007711157875
       310          328    3.811601131273228    0.002506548521166    1.000000000000000    0.000007711359115
       311          329    3.811601127921278    0.004639512347550    1.000000000000000    0.000017205825393
       312          330    3.811601126787905    0.008780171330720    1.000000000000000    0.000035364452352
       313          331    3.811601122671233    0.001890545415301    1.000000000000000    0.000008616973082
       314          332    3.811601121106510    0.001584445861594    1.000000000000000    0.000008387230131
       315          333    3.811601119683262    0.002844007942962    1.000000000000000    0.000008500561407
       316          334    3.811601117591850    0.003760816498594    1.000000000000000    0.000019211221181
       317          335    3.811601114902288    0.006201250764362    1.000000000000000    0.000009185477630
       318          336    3.811601113245145    0.002068987499589    1.000000000000000    0.000007632226712
       319          338    3.811601112387713    0.001521779686884    0.413530829530916    0.000018672367153
       320          339    3.811601110845108    0.002065538854276    1.000000000000000    0.000013748007312
       321          340    3.811601108822115    0.002089020103938    1.000000000000000    0.000009411047080
       322          341    3.811601105268814    0.005361735995305    1.000000000000000    0.000008616194813
       323          342    3.811601103141307    0.003056607129971    1.000000000000000    0.000009456393507
       324          343    3.811601100190317    0.006382175053083    1.000000000000000    0.000018959774512
       325          345    3.811601099116964    0.003041983549109    0.359359648508615    0.000013736561084
       326          346    3.811601097863269    0.001544475639654    1.000000000000000    0.000007630523487
       327          347    3.811601096487133    0.001951345127692    1.000000000000000    0.000008173535944
       328          348    3.811601095225408    0.001757795437088    1.000000000000000    0.000009981502896
       329          349    3.811601094379776    0.004155389291324    1.000000000000000    0.000041447790074
       330          350    3.811601091930441    0.001718280490264    1.000000000000000    0.000012106398130
       331          351    3.811601090838084    0.001101581114330    1.000000000000000    0.000008804447881
       332          352    3.811601089295775    0.002644114514851    1.000000000000000    0.000010751779343
       333          353    3.811601087786781    0.002286268814181    1.000000000000000    0.000009991205205
       334          354    3.811601085040528    0.005420878102807    1.000000000000000    0.000009780460677
       335          356    3.811601083690797    0.002815123156617    0.478498837887636    0.000013207761291
       336          357    3.811601081801137    0.002517012077199    1.000000000000000    0.000009949909236
       337          358    3.811601079572224    0.003400260441219    1.000000000000000    0.000010234522892
       338          359    3.811601077059078    0.002343229175475    1.000000000000000    0.000013641259136
       339          360    3.811601074192173    0.007416189457194    1.000000000000000    0.000027460360184
       340          361    3.811601071736536    0.003489214955716    1.000000000000000    0.000009256219292
       341          362    3.811601070544358    0.001914686208968    1.000000000000000    0.000008251864501
       342          363    3.811601068222416    0.003372853825525    1.000000000000000    0.000007614546987
       343          364    3.811601064445089    0.006321613351676    1.000000000000000    0.000017309429998
       344          365    3.811601063261068    0.007003052570976    1.000000000000000    0.000020622449165
       345          366    3.811601061103239    0.001609719997209    1.000000000000000    0.000005735769544
       346          367    3.811601060413457    0.001070865984243    1.000000000000000    0.000005210193978
       347          368    3.811601059521749    0.001284786390969    1.000000000000000    0.000006036532277
       348          369    3.811601057583712    0.002637865558325    1.000000000000000    0.000007213775932
       349          371    3.811601056538721    0.003716233636829    0.426460283432239    0.000010262983885
       350          372    3.811601054627217    0.003356442651099    1.000000000000000    0.000005797827196
       351          373    3.811601053261158    0.002164850855600    1.000000000000000    0.000004706986151
       352          374    3.811601051312179    0.004766885337318    1.000000000000000    0.000007008502972
       353          375    3.811601050235059    0.003655746453257    1.000000000000000    0.000012763786647
       354          376    3.811601048485534    0.002873472544281    1.000000000000000    0.000007254513542
       355          377    3.811601046768923    0.002630094990892    1.000000000000000    0.000005225598789
       356          378    3.811601045395674    0.002099711661118    1.000000000000000    0.000007304613548
       357          379    3.811601043514965    0.004093211978832    1.000000000000000    0.000010769918872
       358          380    3.811601041674944    0.004224576117272    1.000000000000000    0.000010128026116
       359          381    3.811601039988918    0.002313492301966    1.000000000000000    0.000006486154300
       360          382    3.811601037865170    0.003331352229678    1.000000000000000    0.000007699040754
       361          383    3.811601036597159    0.002684043158369    1.000000000000000    0.000008184438146
       362          384    3.811601034016058    0.009148370508827    1.000000000000000    0.000019098791571
       363          385    3.811601031159990    0.006075130441161    1.000000000000000    0.000008250267659
       364          386    3.811601029422155    0.002520992257026    1.000000000000000    0.000006152587927
       365          387    3.811601027537391    0.003984905873513    1.000000000000000    0.000007400056050
       366          388    3.811601025330106    0.005065157497193    1.000000000000000    0.000008945182071
       367          389    3.811601021611838    0.009967215211692    1.000000000000000    0.000009862309077
       368          390    3.811601019368961    0.010948795839214    1.000000000000000    0.000017026468679
       369          391    3.811601016764415    0.001805688429791    1.000000000000000    0.000007259047769
       370          392    3.811601014799000    0.002596999170396    1.000000000000000    0.000006633616479
       371          393    3.811601013274471    0.002585513260779    1.000000000000000    0.000008184006641
       372          394    3.811601009459535    0.007484404976483    1.000000000000000    0.000008903119701
       373          396    3.811601007505792    0.006260552576609    0.498453897740403    0.000013432300110
       374          397    3.811601004380667    0.005563794372048    1.000000000000000    0.000006780693844
       375          398    3.811601002397034    0.003378482263252    1.000000000000000    0.000005790131227
       376          399    3.811601000775482    0.002789603566047    1.000000000000000    0.000010107749177
       377          400    3.811600998875008    0.004982901441367    1.000000000000000    0.000010151588480
       378          401    3.811600996725953    0.005301053038136    1.000000000000000    0.000013275800697
       379          402    3.811600994371599    0.004607485699592    1.000000000000000    0.000008004130920
       380          403    3.811600992197430    0.004896911624558    1.000000000000000    0.000005811261393
       381          404    3.811600990671289    0.003455465332887    1.000000000000000    0.000007109132675
       382          405    3.811600987890053    0.006493126773312    1.000000000000000    0.000007616894570
       383          406    3.811600986755307    0.007784775602616    1.000000000000000    0.000016732703906
       384          407    3.811600984113309    0.002926590851654    1.000000000000000    0.000005133973495
       385          408    3.811600983214564    0.001703711637023    1.000000000000000    0.000003968960488
       386          409    3.811600982313689    0.001329282548299    1.000000000000000    0.000005836635200
       387          410    3.811600981030785    0.002303113756514    1.000000000000000    0.000006268656100
       388          411    3.811600978449020    0.006010468604954    1.000000000000000    0.000009884023517
       389          412    3.811600976335543    0.009295064116146    1.000000000000000    0.000007053738831
       390          413    3.811600974752381    0.001824326546210    1.000000000000000    0.000004492976157
       391          414    3.811600973505561    0.002821322107883    1.000000000000000    0.000004292814480
       392          415    3.811600972492713    0.002867093005001    1.000000000000000    0.000005771008368
       393          416    3.811600971313539    0.005629219798183    1.000000000000000    0.000007512199354
       394          417    3.811600970180598    0.001893126575655    1.000000000000000    0.000003937670414
       395          418    3.811600969218592    0.001593973488305    1.000000000000000    0.000003780200817
       396          419    3.811600968214886    0.002083292545361    1.000000000000000    0.000004586310564
       397          420    3.811600967118440    0.005710103534468    1.000000000000000    0.000009227161418
       398          421    3.811600965637784    0.003365886742351    1.000000000000000    0.000004043033307
       399          422    3.811600964667242    0.001735027089365    1.000000000000000    0.000004223626417
       400          423    3.811600962660921    0.005200353354679    1.000000000000000    0.000004781679410
       401          424    3.811600959586130    0.008515543664010    1.000000000000000    0.000005838252123
       402          426    3.811600958134991    0.006985388074092    0.370181762886240    0.000008859118712
       403          427    3.811600955609142    0.007474815480853    1.000000000000000    0.000004844505979
       404          428    3.811600953798208    0.003961314041036    1.000000000000000    0.000004716362769
       405          429    3.811600951509280    0.005348228996605    1.000000000000000    0.000006264996652
       406          430    3.811600948793944    0.006470515589568    1.000000000000000    0.000006614627221
       407          431    3.811600945071370    0.010369379399451    1.000000000000000    0.000007864150470
       408          432    3.811600942059829    0.013958211412794    1.000000000000000    0.000019700785012
       409          434    3.811600940961828    0.004390769810126    0.339594795957139    0.000012627299322
       410          435    3.811600939529179    0.001206745566769    1.000000000000000    0.000009622342030
       411          436    3.811600937338727    0.003555584237452    1.000000000000000    0.000006028971198
       412          437    3.811600936235911    0.002376988328324    1.000000000000000    0.000005999812953
       413          438    3.811600934111928    0.007160535254668    1.000000000000000    0.000008225062510
       414          440    3.811600933556433    0.002225468903445    0.229487883770574    0.000012247616963
       415          441    3.811600932378398    0.003280066724243    1.000000000000000    0.000006716901703
       416          442    3.811600931425725    0.002074538593515    1.000000000000000    0.000004272498408
       417          443    3.811600930710938    0.001425217849226    1.000000000000000    0.000004804884020
       418          444    3.811600929455889    0.002541417442447    1.000000000000000    0.000006197070958
       419          446    3.811600928893887    0.001822236044085    0.258120513718107    0.000011185024294
       420          447    3.811600927517426    0.003606676897438    1.000000000000000    0.000006606161147
       421          448    3.811600926481201    0.004094387419802    1.000000000000000    0.000008783477060
       422          449    3.811600925953984    0.004820644038319    1.000000000000000    0.000014698684231
       423          450    3.811600925267847    0.000914514090432    1.000000000000000    0.000005527837219
       424          451    3.811600924747739    0.001111803389126    1.000000000000000    0.000005774578460
       425          452    3.811600924173595    0.001918163732359    1.000000000000000    0.000008158494838
       426          453    3.811600923329662    0.003491718421035    1.000000000000000    0.000010354528260
       427          455    3.811600923063664    0.001443195145790    0.205312294331286    0.000011085014317
       428          456    3.811600922587162    0.002003361915107    1.000000000000000    0.000004857014035
       429          457    3.811600922294806    0.000888884209174    1.000000000000000    0.000003387799925
       430          458    3.811600922035219    0.000656771955336    1.000000000000000    0.000004820314245
       431          459    3.811600921683716    0.000993731324181    1.000000000000000    0.000006325302747
       432          461    3.811600921485320    0.000881367145060    0.358602249700702    0.000008988239906
       433          462    3.811600921192244    0.000775361092916    1.000000000000000    0.000004422323450
       434          463    3.811600920916149    0.001092039391625    1.000000000000000    0.000004326437181
       435          464    3.811600920680689    0.001180522887386    1.000000000000000    0.000005414125795
       436          465    3.811600920219048    0.002119344504976    1.000000000000000    0.000006092332946
       437          467    3.811600919973900    0.001198427271655    0.442891394321069    0.000005911588074
       438          468    3.811600919544365    0.002214668105125    1.000000000000000    0.000002842425376
       439          469    3.811600919231821    0.000913664925933    1.000000000000000    0.000003097716235
       440          470    3.811600918843187    0.001115477993405    1.000000000000000    0.000005366016470
       441          472    3.811600918707995    0.000875730249185    0.364358321787471    0.000005573505376
       442          473    3.811600918419521    0.001221369101224    1.000000000000000    0.000003559654563
       443          474    3.811600918122038    0.001452234640656    1.000000000000000    0.000002874903604
       444          475    3.811600917714798    0.002024659855083    1.000000000000000    0.000003071016693
       445          476    3.811600917126820    0.002889771625174    1.000000000000000    0.000003725796385
       446          478    3.811600916924190    0.001608184858056    0.262403460851050    0.000005817737470
       447          479    3.811600916417314    0.001823632281640    1.000000000000000    0.000003093709481
       448          480    3.811600916052414    0.001110533366205    1.000000000000000    0.000003051850509
       449          481    3.811600915527130    0.001502339106139    1.000000000000000    0.000003424886968
       450          482    3.811600915318009    0.002854734929086    1.000000000000000    0.000008547778113
       451          483    3.811600914587659    0.001072182338114    1.000000000000000    0.000003136117127
       452          484    3.811600914211226    0.001065973012221    1.000000000000000    0.000002618308815
       453          485    3.811600913778334    0.001821916225715    1.000000000000000    0.000003245728739
       454          486    3.811600913274179    0.002337109848064    1.000000000000000    0.000004937603197
       455          488    3.811600912833616    0.002899623768896    0.496342549079362    0.000005831806077
       456          489    3.811600912342333    0.001676234918847    1.000000000000000    0.000003533407944
       457          490    3.811600911863291    0.001586170533269    1.000000000000000    0.000003147951825
       458          491    3.811600911375825    0.001650565824721    1.000000000000000    0.000003718355147
       459          492    3.811600910661026    0.002771793255853    1.000000000000000    0.000003975544141
       460          494    3.811600910359672    0.002093010156817    0.323890048210069    0.000006098299233
       461          495    3.811600909974330    0.001176040702820    1.000000000000000    0.000003317806047
       462          496    3.811600909655253    0.001050826040728    1.000000000000000    0.000002343068954
       463          497    3.811600909403994    0.000821139780814    1.000000000000000    0.000002827605602
       464          498    3.811600908878964    0.001889572024933    1.000000000000000    0.000003833336801
       465          500    3.811600908655096    0.001242077031268    0.356098663443814    0.000005782338829
       466          501    3.811600908237561    0.001703650801742    1.000000000000000    0.000003420279652
       467          502    3.811600907917352    0.001439217892130    1.000000000000000    0.000002361919981
       468          503    3.811600907627522    0.001208099567168    1.000000000000000    0.000002581612102
       469          504    3.811600907239446    0.001644693100196    1.000000000000000    0.000002888709767
       470          505    3.811600906997347    0.002362559396329    1.000000000000000    0.000005311611679
       471          506    3.811600906635298    0.001150100262857    1.000000000000000    0.000003359697347
       472          507    3.811600906479806    0.000604665182896    1.000000000000000    0.000002410028836
       473          508    3.811600906360911    0.000454253553583    1.000000000000000    0.000002102244492
       474          509    3.811600906138081    0.001208292163182    1.000000000000000    0.000001881344976
       475          510    3.811600905988698    0.001944263058581    1.000000000000000    0.000004261425369
       476          511    3.811600905768046    0.001118881044961    1.000000000000000    0.000001434366794
       477          512    3.811600905671949    0.000563117734703    1.000000000000000    0.000001467635900
       478          513    3.811600905530037    0.000802780689465    1.000000000000000    0.000001783097596
       479          514    3.811600905365767    0.001029697043366    1.000000000000000    0.000001793176885
       480          516    3.811600905299172    0.000728503988459    0.358076845651612    0.000002103183393
       481          517    3.811600905239353    0.000728503988459    1.000000000000000    0.000000968813667
Convergence criteria met.
After: gradient norm = 9.68813666752238E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.1027,-0.1027}

Count Table 1:
---------------
h:                 {0.0676,-0.0676}

Count Table 2:
---------------
h:                 {-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {0.2720,-0.2720}

Count Table 5:
---------------
h:                 {0.3569,-0.3569}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}
Activity(exp=5):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-0.6773,-1.0030,-0.3017,-0.6784,-0.7444,-0.8219,-0.1330,-0.6162,-0.6867,-1.0530,-0.9934,-0.7444,-0.8463,-1.0573,-1.7345,0.4497,-0.0450,-0.9934,-0.9727,-0.7558,-1.4381,-0.7471,-0.2682,-0.0450,0.3787,-1.4740,-0.8218,-0.6682,-1.3734,-0.2682,-1.1231,0.0133,-1.4100,-0.5051,0.1714,-1.3734,-0.5051,-1.4100,0.0133,-1.1231,-1.3734,0.1714,-0.6682,-0.8218,-1.4740,0.3787,-0.2682,-1.3734,-0.7471,-1.4381,-0.7558,-0.9727,-0.0450,-0.2682,0.4497,-1.7345,-1.0573,-0.8463,-0.9934,-0.0450,-1.0530,-0.6867,-0.6162,-0.1330,-0.7444,-0.9934,-0.6784,-0.3017,-1.0030,-0.6773,-0.8219,-0.7444}
Dinucleotide(d=1): {-0.2569,-0.3750,0.0560,-0.0640,-0.0372,0.0000,-0.2856,-0.4151,-0.2106,-0.2340,0.1428,0.0000,-0.0328,0.0584,-0.3564,0.0073,0.0219,0.0000,0.2766,0.2554,0.0897,-0.6032,-0.6967,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7442,0.1657,-0.1397,-0.2652,-0.1586,-0.4239,0.0000,-0.2536,-0.4222,-0.6370,0.7109,0.4687,0.0000,-0.1427,-0.1384,-0.0268,-0.0025,-0.3056,0.0000,-0.4070,-0.2166,-0.7378,0.2961,0.3788,0.0000,0.6122,0.0360,0.2052,-1.1815,-0.7244,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9930,-0.6548,-0.3155,-0.5374,0.6262,0.1373,0.0000,0.0501,0.2037,-0.8194,-0.6404,0.3602,0.0000,-0.1041,0.2654,-0.2138,-0.5533,-0.4509,0.0000,0.1345,-0.2359,-1.4213,-0.8070,0.5960,0.0000,-0.4325,-1.1234,2.2282,1.8557,-2.0786,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0451,-0.6199,0.1352,-1.2117,-0.6021,1.3056,0.0000,-0.8281,0.2284,-0.6048,0.0315,0.2010,0.0000,-0.3760,0.1958,-0.6258,-0.3349,0.3857,0.0000,0.9073,-0.6677,-0.8137,-0.2508,-0.6132,0.0000,-0.1284,-1.5731,1.9453,0.2048,-1.1958,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2678,0.8036,0.3433,-0.7228,-0.3186,-0.1506,0.0000,-0.8331,0.7657,-0.1176,0.4601,0.1032,0.0000,0.3580,-1.0799,0.4137,-0.2974,-0.8678,0.0000,-0.6481,0.7026,-0.5123,-0.6204,0.2564,0.0000,-0.0087,0.4671,-0.4041,-0.7224,0.0001,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3728,0.0093,-0.8424,-0.7891,0.6750,0.6794,0.0000,0.0877,0.2038,-0.6067,-0.8566,0.0373,0.0000,0.9551,-0.8892,0.6479,-0.6067,-0.0788,0.0000,-0.8754,0.6433,-0.8892,0.2038,-0.5155,0.0000,0.1401,-0.8754,0.9551,0.0877,-0.8038,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1737,-0.8038,-0.5155,-0.0788,0.0373,-0.0095,0.0000,-0.7224,-0.6204,-0.2974,0.4601,0.6750,0.0000,-0.4041,-0.5123,0.4137,-0.1176,-0.7891,0.0000,0.4671,0.7026,-1.0799,0.7657,-0.8424,0.0000,-0.0087,-0.6481,0.3580,-0.8331,0.0093,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3728,0.0001,0.2564,-0.8678,0.1032,0.6794,0.0000,0.2048,-0.2508,-0.3349,0.0315,-0.3186,0.0000,1.9453,-0.8137,-0.6258,-0.6048,-0.7228,0.0000,-1.5731,-0.6677,0.1958,0.2284,0.3433,0.0000,-0.1284,0.9073,-0.3760,-0.8281,0.8036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2678,-1.1958,-0.6132,0.3857,0.2010,-0.1506,0.0000,1.8557,-0.8070,-0.5533,-0.6404,-0.6021,0.0000,2.2282,-1.4213,-0.2138,-0.8194,-1.2117,0.0000,-1.1234,-0.2359,0.2654,0.2037,0.1352,0.0000,-0.4325,0.1345,-0.1041,0.0501,-0.6199,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0451,-2.0786,0.5960,-0.4509,0.3602,1.3056,0.0000,-1.1815,0.2961,-0.0025,0.7109,0.6262,0.0000,0.2052,-0.7378,-0.0268,-0.6370,-0.5374,0.0000,0.0360,-0.2166,-0.1384,-0.4222,-0.3155,0.0000,0.6122,-0.4070,-0.1427,-0.2536,-0.6548,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9930,-0.7244,0.3788,-0.3056,0.4687,0.1373,0.0000,-0.6032,0.0073,-0.2340,-0.0640,-0.1586,0.0000,0.0897,-0.3564,-0.2106,0.0560,-0.2652,0.0000,0.2554,0.0584,-0.4151,-0.3750,-0.1397,0.0000,0.2766,-0.0328,-0.2856,-0.2569,0.1657,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7442,-0.6967,0.0219,0.1428,-0.0372,-0.4239,0.0000}
Activity(exp=0):   {0.0024,-1.8380}
Activity(exp=1):   {0.0024,-2.1995}
Activity(exp=2):   {0.0024,0.0024}
Activity(exp=3):   {0.0024,0.0024}
Activity(exp=4):   {0.0024,-0.3357}
Activity(exp=5):   {0.0024,0.0187}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

> Optimizing the full model (component1-4-all).
>>  Starting new optimization: component1-4-all. (2021-05-21 18:02:35.622).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[261,262]},{"h":[263,264]},{"h":[265,266]},{"h":[267,268]},{"h":[269,270]},{"h":[271,272]}],"bindingModeInteractions":[],"bindingModes":[{"mononucleotide":[],"activity":[[0,1],[2,3],[4,5],[6,7],[8,9],[10,11]]},{"mononucleotide":[13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,37,36,41,40,38,39,43,42,47,46,44,45,46,47,42,43,45,44,40,41,36,37,39,38,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14],"activity":[[249,250],[251,252],[253,254],[255,256],[257,258],[259,260]],"dinucleotide":[[55,54,59,58,56,57,49,48,53,52,50,51,79,78,83,82,80,81,73,72,77,76,74,75,61,60,65,64,62,63,67,66,71,70,68,69,91,90,95,94,92,93,85,84,89,88,86,87,115,114,119,118,116,117,109,108,113,112,110,111,97,96,101,100,98,99,103,102,107,106,104,105,127,126,131,130,128,129,121,120,125,124,122,123,151,150,155,154,152,153,145,144,149,148,146,147,133,132,137,136,134,135,139,138,143,142,140,141,163,162,167,166,164,165,157,156,161,160,158,159,187,186,191,190,188,189,181,180,185,184,182,183,169,168,173,172,170,171,175,174,179,178,176,177,199,198,203,202,200,201,193,192,197,196,194,195,223,222,227,226,224,225,217,216,221,220,218,219,205,204,209,208,206,207,211,210,215,214,212,213,235,234,232,238,236,237,229,228,233,232,230,231,246,248,228,234,243,239,247,246,229,235,244,240,240,239,231,237,241,242,244,243,230,236,245,241,220,226,196,202,214,208,221,227,197,203,215,209,216,222,192,198,210,204,217,223,193,199,211,205,219,225,195,201,213,207,218,224,194,200,212,206,184,190,160,166,178,172,185,191,161,167,179,173,180,186,156,162,174,168,181,187,157,163,175,169,183,189,159,165,177,171,182,188,158,164,176,170,148,154,124,130,142,136,149,155,125,131,143,137,144,150,120,126,138,132,145,151,121,127,139,133,147,153,123,129,141,135,146,152,122,128,140,134,112,118,88,94,106,100,113,119,89,95,107,101,108,114,84,90,102,96,109,115,85,91,103,97,111,117,87,93,105,99,110,116,86,92,104,98,76,82,52,58,70,64,77,83,53,59,71,65,72,78,48,54,66,60,73,79,49,55,67,61,75,81,51,57,69,63,74,80,50,56,68,62]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 3.8116009052393527
gradient      = {-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000}
gradient norm = 5.534572175251069E-6
Starting Function Value: 3.8116009052393527
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.811600905163119    0.000027038910527    4.885456304557035    0.000008333830314
         2            4    3.811600905057803    0.000023511251784    1.000000000000000    0.000008273174168
         3            5    3.811600902226177    0.001342189958856    1.000000000000000    0.000020117956362
         4            7    3.811600901696800    0.000223008402686    0.205951095099920    0.000015313145746
         5            8    3.811600901368659    0.000031363162307    1.000000000000000    0.000012443697847
         6            9    3.811600900341492    0.000270300193123    1.000000000000000    0.000014174687430
         7           10    3.811600899396250    0.000484246992767    1.000000000000000    0.000020391116255
         8           11    3.811600898053154    0.000929766591565    1.000000000000000    0.000023314001627
         9           12    3.811600896131901    0.000913676363690    1.000000000000000    0.000022208429831
        10           13    3.811600890483989    0.002998247029187    1.000000000000000    0.000038648599890
        11           14    3.811600884258368    0.004009531019789    1.000000000000000    0.000066171491379
        12           15    3.811600876478062    0.003386699226505    1.000000000000000    0.000050802890481
        13           16    3.811600865166158    0.004633152677680    1.000000000000000    0.000037997447456
        14           17    3.811600852393711    0.005583427965334    1.000000000000000    0.000048766861691
        15           18    3.811600833457970    0.010339973743797    1.000000000000000    0.000069000840569
        16           19    3.811600817976535    0.013682930979587    1.000000000000000    0.000095434372663
        17           20    3.811600801394479    0.004644618749928    1.000000000000000    0.000047449063162
        18           21    3.811600786896168    0.004296435693624    1.000000000000000    0.000049076273663
        19           22    3.811600773186825    0.005298817942513    1.000000000000000    0.000067031287207
        20           23    3.811600742416733    0.014602300391295    1.000000000000000    0.000081125378765
        21           24    3.811600688840992    0.026454442810108    1.000000000000000    0.000084424314482
        22           25    3.811600685380363    0.062344910817119    1.000000000000000    0.000374782470424
        23           26    3.811600571732964    0.010990749787299    1.000000000000000    0.000087815366426
        24           27    3.811600535245928    0.003928026878452    1.000000000000000    0.000066517813147
        25           28    3.811600481091089    0.026809630932717    1.000000000000000    0.000100601188986
        26           29    3.811600409069283    0.025774274756801    1.000000000000000    0.000109070912523
        27           30    3.811600305127299    0.080954647336792    1.000000000000000    0.000076673585049
        28           31    3.811600213787504    0.041580638046557    1.000000000000000    0.000099823389405
        29           32    3.811600120484390    0.043273713392696    1.000000000000000    0.000083122481316
        30           33    3.811600021730082    0.043537801955018    1.000000000000000    0.000082661803200
        31           34    3.811599787879570    0.108237225900385    1.000000000000000    0.000100012503759
        32           35    3.811599605474298    0.187625062501859    1.000000000000000    0.000130975123167
        33           36    3.811599453226822    0.031118405038034    1.000000000000000    0.000070543400278
        34           37    3.811599363444626    0.014470178324350    1.000000000000000    0.000063696629212
        35           38    3.811599216477309    0.047073381207472    1.000000000000000    0.000060223907670
        36           39    3.811598988133646    0.111524270385273    1.000000000000000    0.000062968359107
        37           40    3.811598755133677    0.148206007272865    1.000000000000000    0.000088777542975
        38           41    3.811598625952998    0.103610716543958    1.000000000000000    0.000052094895902
        39           42    3.811598565576542    0.036580695599828    1.000000000000000    0.000041528928041
        40           43    3.811598490205756    0.024012641360859    1.000000000000000    0.000048729219555
        41           44    3.811598298370788    0.080069807279863    1.000000000000000    0.000073301451203
        42           45    3.811598128941343    0.089460570348131    1.000000000000000    0.000066641184060
        43           46    3.811598025054301    0.064291419572352    1.000000000000000    0.000041404472195
        44           47    3.811597959054652    0.038207457894697    1.000000000000000    0.000036572944104
        45           48    3.811597885738244    0.036191899102139    1.000000000000000    0.000043586090160
        46           49    3.811597803671524    0.045958175771722    1.000000000000000    0.000036445534830
        47           50    3.811597749214324    0.030499820055234    1.000000000000000    0.000042746027949
        48           51    3.811597709895318    0.021337480645159    1.000000000000000    0.000024335436631
        49           52    3.811597684686377    0.009500877197214    1.000000000000000    0.000025391851790
        50           53    3.811597643123390    0.018449881959142    1.000000000000000    0.000031252642241
        51           54    3.811597613127464    0.017256745960041    1.000000000000000    0.000022637402226
        52           55    3.811597583358565    0.016384589301693    1.000000000000000    0.000027058547382
        53           56    3.811597537408650    0.029194407632502    1.000000000000000    0.000028221326323
        54           57    3.811597508686307    0.022806455708670    1.000000000000000    0.000032433103331
        55           58    3.811597486164992    0.006442081109051    1.000000000000000    0.000020965398491
        56           59    3.811597462811226    0.006179915575458    1.000000000000000    0.000019146344330
        57           60    3.811597446420966    0.007547720528604    1.000000000000000    0.000017010870809
        58           61    3.811597427330824    0.013388957332906    1.000000000000000    0.000019176894511
        59           62    3.811597413985472    0.011798690804100    1.000000000000000    0.000015525953535
        60           63    3.811597403387242    0.009805922718594    1.000000000000000    0.000017371505617
        61           64    3.811597385698541    0.009934359133406    1.000000000000000    0.000021255117905
        62           65    3.811597374347813    0.014901483640932    1.000000000000000    0.000029201222074
        63           66    3.811597364036155    0.004564828037731    1.000000000000000    0.000009382928268
        64           67    3.811597360430435    0.002358816730697    1.000000000000000    0.000008946059484
        65           68    3.811597353580161    0.001626809675602    1.000000000000000    0.000011832313472
        66           69    3.811597338540059    0.007347646414118    1.000000000000000    0.000014602098454
        67           70    3.811597322423203    0.015005084738058    1.000000000000000    0.000025546894139
        68           71    3.811597313317227    0.011531183149082    1.000000000000000    0.000010169908892
        69           72    3.811597310007985    0.004785285850147    1.000000000000000    0.000007455140940
        70           73    3.811597306716911    0.002057761927621    1.000000000000000    0.000008304864297
        71           74    3.811597301338014    0.003130412297531    1.000000000000000    0.000010588057479
        72           75    3.811597294380582    0.004460467531923    1.000000000000000    0.000011093791200
        73           76    3.811597291263324    0.009484605062283    1.000000000000000    0.000023921022973
        74           77    3.811597283431779    0.001417663371608    1.000000000000000    0.000006298788996
        75           78    3.811597281612667    0.000569371204400    1.000000000000000    0.000005063375680
        76           79    3.811597278593662    0.002201770392195    1.000000000000000    0.000006753273791
        77           80    3.811597274382959    0.004644943971185    1.000000000000000    0.000007182066698
        78           81    3.811597269522726    0.005613915405342    1.000000000000000    0.000007122713843
        79           82    3.811597266225001    0.005916022368627    1.000000000000000    0.000008272037833
        80           83    3.811597263626689    0.002692317911071    1.000000000000000    0.000007787759817
        81           84    3.811597259534014    0.004077760770236    1.000000000000000    0.000009440986154
        82           85    3.811597255464255    0.004734842602741    1.000000000000000    0.000007966037497
        83           86    3.811597253457259    0.001868271230530    1.000000000000000    0.000004304676739
        84           87    3.811597252006377    0.001186398114536    1.000000000000000    0.000004392043631
        85           88    3.811597250355549    0.002004327078997    1.000000000000000    0.000004796405941
        86           89    3.811597247076263    0.004388726623726    1.000000000000000    0.000006219132485
        87           90    3.811597245345691    0.003797297714131    1.000000000000000    0.000006311623571
        88           91    3.811597244338841    0.001601922743761    1.000000000000000    0.000005436845095
        89           92    3.811597243208295    0.001263710078701    1.000000000000000    0.000004148075254
        90           93    3.811597241473570    0.002042520174467    1.000000000000000    0.000004057326975
        91           94    3.811597240037946    0.002104864975074    1.000000000000000    0.000004122229237
        92           95    3.811597238833024    0.002068709111963    1.000000000000000    0.000003176819945
        93           96    3.811597237868579    0.001870300145403    1.000000000000000    0.000003926759258
        94           97    3.811597236751979    0.002122895222185    1.000000000000000    0.000003341224457
        95           98    3.811597235811399    0.001663091223051    1.000000000000000    0.000003395168430
        96           99    3.811597234699740    0.002035814154020    1.000000000000000    0.000004782068917
        97          100    3.811597234092295    0.001190761702071    1.000000000000000    0.000002586881188
        98          101    3.811597233666828    0.000738963165445    1.000000000000000    0.000002654817683
        99          102    3.811597232794922    0.001562705489439    1.000000000000000    0.000003660287651
       100          103    3.811597231919592    0.002152133112100    1.000000000000000    0.000002250401668
       101          104    3.811597231443355    0.001267792923132    1.000000000000000    0.000002530781728
       102          105    3.811597231391497    0.001835337729832    1.000000000000000    0.000020036773484
       103          106    3.811597230808014    0.000396827066552    1.000000000000000    0.000003677500833
       104          107    3.811597230624623    0.000258176758102    1.000000000000000    0.000002082365401
       105          108    3.811597230290049    0.000809697485182    1.000000000000000    0.000004057519478
       106          110    3.811597230266362    0.000095888139416    0.094812533438190    0.000004369280033
       107          111    3.811597230181024    0.000386743433325    1.000000000000000    0.000003109203113
       108          112    3.811597230011968    0.000729670684553    1.000000000000000    0.000002548766650
       109          113    3.811597229673521    0.001095034655364    1.000000000000000    0.000003381625128
       110          114    3.811597229365122    0.001229839330696    1.000000000000000    0.000003475171571
       111          115    3.811597229151297    0.000823669028282    1.000000000000000    0.000003900443236
       112          116    3.811597229059338    0.000541540161895    1.000000000000000    0.000009161976766
       113          117    3.811597228941304    0.000189100711960    1.000000000000000    0.000002077561398
       114          118    3.811597228887098    0.000161746136232    1.000000000000000    0.000002111678178
       115          119    3.811597228800746    0.000369549807054    1.000000000000000    0.000003122310584
       116          120    3.811597228748751    0.000727582045171    1.000000000000000    0.000011430650223
       117          121    3.811597228625741    0.000298257577043    1.000000000000000    0.000004622747230
       118          122    3.811597228482313    0.000507402845905    1.000000000000000    0.000003091616415
       119          123    3.811597228322880    0.000633794160749    1.000000000000000    0.000006262638227
       120          124    3.811597228151368    0.000630751463196    1.000000000000000    0.000006196010295
       121          125    3.811597227968469    0.000710466633186    1.000000000000000    0.000009482544342
       122          126    3.811597227750213    0.000844188523915    1.000000000000000    0.000003019173577
       123          127    3.811597227632194    0.000377936491456    1.000000000000000    0.000003589618138
       124          128    3.811597227505299    0.000382188383938    1.000000000000000    0.000004229651115
       125          129    3.811597227388848    0.001129410645790    1.000000000000000    0.000007653340678
       126          130    3.811597227237182    0.000605547056779    1.000000000000000    0.000004721682497
       127          131    3.811597227073893    0.000484202980539    1.000000000000000    0.000004100585065
       128          132    3.811597226922383    0.000778459048282    1.000000000000000    0.000004087823557
       129          133    3.811597226844862    0.000455650084441    1.000000000000000    0.000008125651709
       130          134    3.811597226745029    0.000221546425295    1.000000000000000    0.000004581446127
       131          135    3.811597226588922    0.000567676050982    1.000000000000000    0.000003564554249
       132          136    3.811597226505258    0.000443069120357    1.000000000000000    0.000004097542628
       133          137    3.811597226352188    0.000732617530202    1.000000000000000    0.000003186366495
       134          138    3.811597226286192    0.000740046108624    1.000000000000000    0.000007247078141
       135          139    3.811597226188359    0.000603575188235    1.000000000000000    0.000003309980718
       136          140    3.811597226138084    0.000430374591493    1.000000000000000    0.000003278492802
       137          141    3.811597226040367    0.000748188175134    1.000000000000000    0.000003271082746
       138          142    3.811597225913080    0.000511258715937    1.000000000000000    0.000002940382893
       139          143    3.811597225720318    0.000791500319263    1.000000000000000    0.000003332491648
       140          144    3.811597225525332    0.001156072857622    1.000000000000000    0.000003785299741
       141          145    3.811597225287635    0.001579134939958    1.000000000000000    0.000003581497428
       142          146    3.811597225046056    0.001937860255084    1.000000000000000    0.000004639778654
       143          147    3.811597224835973    0.000928917194685    1.000000000000000    0.000003195407744
       144          148    3.811597224667897    0.000314871461147    1.000000000000000    0.000002981536623
       145          149    3.811597224574319    0.000425618889228    1.000000000000000    0.000002552113778
       146          150    3.811597224460296    0.001152231419287    1.000000000000000    0.000003778738394
       147          151    3.811597224394756    0.000533612020716    1.000000000000000    0.000002445642206
       148          152    3.811597224345806    0.000318089189067    1.000000000000000    0.000002117822884
       149          153    3.811597224283539    0.000544039838542    1.000000000000000    0.000002244411695
       150          154    3.811597224224808    0.000570538761379    1.000000000000000    0.000002302596224
       151          155    3.811597224145993    0.000608864542981    1.000000000000000    0.000002284789183
       152          156    3.811597224071341    0.000283965037437    1.000000000000000    0.000002097155182
       153          157    3.811597223997528    0.000711135998196    1.000000000000000    0.000001772272361
       154          158    3.811597223927528    0.001160360429811    1.000000000000000    0.000001608049967
       155          159    3.811597223852500    0.001543456808407    1.000000000000000    0.000001875908468
       156          160    3.811597223771726    0.001576061217412    1.000000000000000    0.000002128591191
       157          161    3.811597223680178    0.001232348366094    1.000000000000000    0.000002439391016
       158          162    3.811597223589184    0.000624764612186    1.000000000000000    0.000001886541030
       159          163    3.811597223528829    0.000495907613763    1.000000000000000    0.000002156370940
       160          164    3.811597223480313    0.000415397253693    1.000000000000000    0.000001350251931
       161          165    3.811597223428735    0.000274120900522    1.000000000000000    0.000001900647384
       162          166    3.811597223372659    0.000386539363877    1.000000000000000    0.000002449486381
       163          167    3.811597223283643    0.001176384488722    1.000000000000000    0.000002601831008
       164          168    3.811597223178874    0.001772257712518    1.000000000000000    0.000002705727169
       165          169    3.811597223036760    0.002032776523632    1.000000000000000    0.000001541985911
       166          170    3.811597222909734    0.000870456484357    1.000000000000000    0.000001722603427
       167          171    3.811597222724243    0.001221024539840    1.000000000000000    0.000002814910816
       168          172    3.811597222592109    0.000786406752319    1.000000000000000    0.000002201922778
       169          173    3.811597222441350    0.001177200320918    1.000000000000000    0.000001405501108
       170          174    3.811597222343639    0.000761593855631    1.000000000000000    0.000002235085522
       171          175    3.811597222183511    0.001164765364240    1.000000000000000    0.000003726099448
       172          176    3.811597221957440    0.001691479086367    1.000000000000000    0.000004229492478
       173          177    3.811597221573821    0.002987777313101    1.000000000000000    0.000003730294388
       174          178    3.811597221298289    0.002793665991943    1.000000000000000    0.000001662668287
       175          179    3.811597221190448    0.000754770251365    1.000000000000000    0.000001784132773
       176          180    3.811597221111950    0.000349051944828    1.000000000000000    0.000002299559365
       177          181    3.811597220980946    0.000616466426287    1.000000000000000    0.000002436787947
       178          182    3.811597220869178    0.002003970990527    1.000000000000000    0.000004241555852
       179          183    3.811597220713645    0.000469224101113    1.000000000000000    0.000001303594829
       180          184    3.811597220655194    0.000596909923803    1.000000000000000    0.000001261116584
       181          185    3.811597220609276    0.000547196377481    1.000000000000000    0.000001375581441
       182          186    3.811597220544924    0.000866980330272    1.000000000000000    0.000001599164369
       183          187    3.811597220530718    0.001311838905809    1.000000000000000    0.000002605455390
       184          188    3.811597220470425    0.001311838905809    1.000000000000000    0.000000929882164
Convergence criteria met.
After: gradient norm = 9.298821636899628E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5862,-0.5862}

Count Table 2:
---------------
h:                 {0.0000,-0.0000}

Count Table 3:
---------------
h:                 {0.0000,-0.0000}

Count Table 4:
---------------
h:                 {0.3812,-0.3812}

Count Table 5:
---------------
h:                 {0.3792,-0.3792}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}


==================================
== Starts fiting Binding mode 2 ==
==================================
> Optimizing h (component2-0-h).
>>  Starting new optimization: component2-0-h. (2021-05-21 18:10:16.547).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[0,1]},{"h":[2,3]},{"h":[4,5]},{"h":[6,7]},{"h":[8,9]},{"h":[10,11]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 5.399479675337159
gradient      = {-0.0000,0.0000,-0.0000,0.0000,-0.4054,0.4054,-0.3474,0.3474,-0.3676,0.3676,-0.2829,0.2829}
gradient norm = 1.0001533685018544
Starting Function Value: 5.399479675337159
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            2    4.528853034106944    1.000000000000000    0.999846655016436    0.723815796407443
         2            3    4.063493799477711    2.721982716703495    1.000000000000000    0.415749032516962
         3            4    3.852088059054915    1.002991462129803    1.000000000000000    0.011427455608216
         4            5    3.851942187307744    0.026346047702348    1.000000000000000    0.000832254572215
         5            6    3.851941441769771    0.001771294456709    1.000000000000000    0.000061424684438
         6            7    3.851941429704246    0.000148265103352    1.000000000000000    0.000001426798267
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {5.4279e-01,-5.4279e-01,5.8622e-01,-5.8622e-01,1.1753e+00,-1.1753e+00,9.1969e-01,-9.1969e-01,1.4153e+00,-1.4153e+00,1.1390e+00,-1.1390e+00}
> Gradient:  {1.5050e-12,-1.5050e-12,3.2451e-13,-3.2451e-13,-3.5965e-07,3.5965e-07,-2.9658e-07,2.9658e-07,-3.7077e-07,3.7077e-07,-8.1430e-07,8.1430e-07}
>>>> Re-trying (1/3).
Starting Function Value: 3.8519414373969028
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.851941437163399    0.000003404156505    2.385769908735938    0.000000098619206
         2            4    3.851941437163385    0.000003404156505    1.000000000000000    0.000000007437353
Convergence criteria met.
After: gradient norm = 7.437352801972699E-9
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5862,-0.5862}

Count Table 2:
---------------
h:                 {1.1753,-1.1753}

Count Table 3:
---------------
h:                 {0.9197,-0.9197}

Count Table 4:
---------------
h:                 {1.4153,-1.4153}

Count Table 5:
---------------
h:                 {1.1390,-1.1390}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {4.3755,5.2520}
Activity(exp=1):   {4.3755,5.4089}
Activity(exp=2):   {4.3714,4.3714}
Activity(exp=3):   {4.3714,4.3714}
Activity(exp=4):   {4.3755,4.5917}
Activity(exp=5):   {4.3755,4.4186}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

> Initial optimization (component2-1-f1).
>>  Starting new optimization: component2-1-f1. (2021-05-21 18:10:41.315).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.851941454675771
gradient      = {0.0313,-0.0004,-0.0040,-0.0050,0.0239,0.0433,0.0397,-0.0225,-0.0030,-0.0040,0.0337,0.0453,0.0317,0.0042,-0.0052,-0.0030,0.0176,0.0439,0.0229,0.0089,-0.0042,-0.0052,0.0468,0.0198,0.0242,-0.0292,-0.0066,-0.0042,-0.0030,0.1079,0.0889,0.0043,-0.0406,-0.0066,0.0052,0.0380,0.0000,0.0000,0.0000,0.0000,0.0000,0.0029,0.0000,0.0065,0.0000,0.0141,0.0000,0.0211,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000}
gradient norm = 0.20055144008501286
Starting Function Value: 3.851941454675771
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.843393294749353    0.086483987310875    0.431230946405646    0.180415792229807
         2            4    3.835859183910921    0.057768104656573    1.000000000000000    0.169083352253582
         3            5    3.776267213213167    1.353032974452009    1.000000000000000    0.386137713330108
         4            6    3.758850077127265    0.340081239685386    1.000000000000000    0.052820543639721
         5            7    3.755206198255042    0.150177013351281    1.000000000000000    0.052705001619696
         6            8    3.741902272205190    0.530165148006062    1.000000000000000    0.086700026214698
         7            9    3.734635085590825    0.270032263432228    1.000000000000000    0.050834639419080
         8           10    3.730221473860071    0.234869410262726    1.000000000000000    0.032330324752062
         9           11    3.725663436739529    0.348273707790729    1.000000000000000    0.040907666755264
        10           12    3.717489196186500    0.891794014407943    1.000000000000000    0.127135023870197
        11           13    3.711887357550834    0.158641367371459    1.000000000000000    0.072015298579986
        12           14    3.705523877316904    0.499366363773466    1.000000000000000    0.069060950992947
        13           15    3.699537918869445    0.423193150646637    1.000000000000000    0.048531165527557
        14           16    3.695086435068617    0.562124887318264    1.000000000000000    0.057964812774494
        15           17    3.692819904142192    0.216765284438057    1.000000000000000    0.028216976849774
        16           18    3.690751496200017    0.363395531743493    1.000000000000000    0.035316868770690
        17           19    3.688542994868414    0.383081688573427    1.000000000000000    0.036907008717216
        18           20    3.686813901311083    0.321431984544651    1.000000000000000    0.030777459354567
        19           21    3.685141540033090    0.342280710159890    1.000000000000000    0.018572043748195
        20           22    3.684063626246504    0.294366069399087    1.000000000000000    0.011471514053004
        21           23    3.682686701355091    0.479004674592480    1.000000000000000    0.009711847759737
        22           24    3.681163875168919    0.751525883505304    1.000000000000000    0.013500250269565
        23           25    3.679596538571964    0.846152752622730    1.000000000000000    0.009952228644822
        24           26    3.678632704190389    0.786107295821397    1.000000000000000    0.013683487811567
        25           27    3.677846984402888    0.523317487200332    1.000000000000000    0.012503853939511
        26           29    3.677486828190319    0.329931605702450    0.365158097788392    0.015590678651532
        27           30    3.676904333294393    0.347939995554951    1.000000000000000    0.008009487152882
        28           31    3.676594403840436    0.202279156683992    1.000000000000000    0.005442019664239
        29           32    3.676310704788266    0.165031007319481    1.000000000000000    0.005273736305726
        30           33    3.676040491454830    0.304259649569113    1.000000000000000    0.013764178660580
        31           34    3.675633928896540    0.232173546711666    1.000000000000000    0.005863361599898
        32           35    3.675359498633863    0.267877967332035    1.000000000000000    0.005364048233854
        33           36    3.675068035620114    0.484780598896177    1.000000000000000    0.003904467710936
        34           37    3.674959300671261    0.291302979315208    1.000000000000000    0.003970071814868
        35           38    3.674855284976904    0.314441628437138    1.000000000000000    0.003203414477844
        36           39    3.674812022392088    0.137514221038602    1.000000000000000    0.002639423953808
        37           40    3.674776000127365    0.061613534979303    1.000000000000000    0.001684410716145
        38           41    3.674731874431234    0.100182679128132    1.000000000000000    0.001494018150242
        39           42    3.674672228712191    0.140066270002742    1.000000000000000    0.001973954475038
        40           43    3.674603704523156    0.163952118932503    1.000000000000000    0.001764489353360
        41           44    3.674537076176670    0.235706869952409    1.000000000000000    0.001210648846916
        42           45    3.674499419927362    0.227900436542623    1.000000000000000    0.001054234373540
        43           46    3.674480112555206    0.163685821688725    1.000000000000000    0.000912962460364
        44           47    3.674463920372859    0.121588372430756    1.000000000000000    0.000830873529373
        45           48    3.674449358520424    0.087915331282918    1.000000000000000    0.001058326966093
        46           49    3.674435332324820    0.081877342656320    1.000000000000000    0.001427942266771
        47           50    3.674417475569300    0.128256129064646    1.000000000000000    0.001507448475198
        48           51    3.674388408760099    0.206867894415199    1.000000000000000    0.001084533274259
        49           52    3.674356559653198    0.273537420777017    1.000000000000000    0.000910433927978
        50           53    3.674337606069690    0.119478683057779    1.000000000000000    0.001246103540218
        51           54    3.674323754256346    0.060367302836120    1.000000000000000    0.001271657990280
        52           55    3.674310102340062    0.077981520579947    1.000000000000000    0.000965831250180
        53           56    3.674294858079349    0.133770289051129    1.000000000000000    0.000494113950775
        54           57    3.674287992548305    0.082499244217215    1.000000000000000    0.000503414299705
        55           58    3.674279233195110    0.110035347002720    1.000000000000000    0.000517078076269
        56           59    3.674269663189385    0.154848693767949    1.000000000000000    0.000541971208026
        57           60    3.674254190948490    0.187279567508667    1.000000000000000    0.000741678830671
        58           61    3.674247996879652    0.085486504141551    1.000000000000000    0.000418253043497
        59           63    3.674247060271597    0.008267394380482    0.219697458463750    0.000412206362878
        60           64    3.674239353871815    0.085938003668602    1.000000000000000    0.000541141869332
        61           65    3.674234497316368    0.069060470332304    1.000000000000000    0.000398074546488
        62           66    3.674230400585588    0.073220164608117    1.000000000000000    0.000392208451187
        63           67    3.674227448312342    0.047699502291995    1.000000000000000    0.000288279149419
        64           68    3.674225697869716    0.033325749883445    1.000000000000000    0.000211556807703
        65           69    3.674224659007440    0.020499461374744    1.000000000000000    0.000221061701286
        66           70    3.674222695588563    0.042085576740705    1.000000000000000    0.000244552678016
        67           72    3.674222250870501    0.008416994952738    0.152172368886258    0.000236440605909
        68           73    3.674216133011070    0.110512791041402    1.000000000000000    0.000143416994144
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9717e+00,-1.5121e+00,-1.2853e+00,-1.4102e+00,-1.0097e+00,-1.4021e+00,-1.5919e+00,-1.0936e-02,-2.4001e+00,-1.2853e+00,-2.4104e+00,-8.9230e-01,-2.8674e+00,-2.8667e+00,-1.1589e+00,-2.4001e+00,1.7706e+00,-3.9022e+00,-3.9875e+00,-3.4755e+00,-2.8403e+00,-1.1589e+00,8.3903e-01,-8.0172e-01,-4.0590e+00,-1.5877e-01,-3.5150e+00,-2.8403e+00,-7.5201e-01,-9.9760e-02,-5.4780e-01,-2.4499e+00,-4.2599e-01,-3.5150e+00,-2.0222e+00,-2.4638e+00,4.2530e+00,5.1050e+00,4.2530e+00,5.2575e+00,4.2490e+00,4.4180e+00,4.2490e+00,4.6740e+00,4.2530e+00,2.2620e+00,4.2530e+00,2.4697e+00,5.4269e-01,-5.4269e-01,5.8626e-01,-5.8626e-01,9.7551e-02,-9.7551e-02,1.9006e-01,-1.9006e-01,3.8348e-01,-3.8348e-01,3.8435e-01,-3.8435e-01}
> Gradient:  {2.2259e-05,1.0130e-05,2.0290e-06,-7.6886e-06,-5.2234e-06,1.1799e-05,4.0485e-05,-2.3028e-06,8.3279e-06,2.0290e-06,-1.3358e-05,-1.8777e-06,-1.6215e-05,4.7603e-06,1.4281e-05,8.3279e-06,1.3184e-05,-2.3697e-06,1.3187e-07,-9.2869e-06,-7.0375e-06,1.4281e-05,9.5124e-06,1.4367e-05,-3.2307e-06,1.4390e-05,1.9229e-06,-7.0375e-06,-3.5225e-06,1.9446e-05,1.7059e-05,1.7233e-05,6.9955e-06,1.9229e-06,-1.2053e-05,-9.1898e-06,8.5060e-06,1.0210e-05,8.5060e-06,1.0515e-05,8.4981e-06,-2.5316e-08,8.4981e-06,5.1426e-05,8.5060e-06,-1.5580e-06,8.5060e-06,1.1639e-05,-4.7061e-05,4.7061e-05,1.8430e-05,-1.8430e-05,2.6330e-05,-2.6330e-05,-3.3346e-05,3.3346e-05,-2.7258e-05,2.7258e-05,-2.6691e-05,2.6691e-05}
>>>> Re-trying (1/3).
Starting Function Value: 3.6742184422084994
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.674218318531539    0.000524824437762    3.648479029838824    0.000109084102681
         2            7    3.674218305254422    0.000177855789959    0.552271710998798    0.000106522955594
         3            8    3.674217732839853    0.011223105246893    1.000000000000000    0.000248055009154
         4           11    3.674217726449386    0.000093034012401    0.006677549372116    0.000246377776555
         5           12    3.674217120957492    0.015359239349758    1.000000000000000    0.000233475630287
         6           13    3.674216970723267    0.006547637138828    1.000000000000000    0.000214289419733
         7           14    3.674216883977763    0.002754369557165    1.000000000000000    0.000103091885399
         8           15    3.674216519932127    0.000860759410089    1.000000000000000    0.000110849703037
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9796e+00,-1.5144e+00,-1.2856e+00,-1.4063e+00,-1.0056e+00,-1.4029e+00,-1.6061e+00,-6.4255e-03,-2.4039e+00,-1.2856e+00,-2.4039e+00,-8.8852e-01,-2.8600e+00,-2.8687e+00,-1.1652e+00,-2.4039e+00,1.7757e+00,-3.9011e+00,-3.9875e+00,-3.4711e+00,-2.8370e+00,-1.1652e+00,8.4212e-01,-8.0437e-01,-4.0574e+00,-1.6088e-01,-3.5159e+00,-2.8370e+00,-7.4907e-01,-1.0271e-01,-5.5169e-01,-2.4560e+00,-4.2469e-01,-3.5159e+00,-2.0157e+00,-2.4590e+00,4.2491e+00,5.1003e+00,4.2491e+00,5.2527e+00,4.2452e+00,4.4180e+00,4.2452e+00,4.6563e+00,4.2491e+00,2.2628e+00,4.2491e+00,2.4645e+00,5.4284e-01,-5.4284e-01,5.8617e-01,-5.8617e-01,9.7673e-02,-9.7673e-02,1.8992e-01,-1.8992e-01,3.8354e-01,-3.8354e-01,3.8442e-01,-3.8442e-01}
> Gradient:  {-1.3719e-06,5.1561e-07,-2.9356e-06,-6.9677e-06,2.4816e-05,2.0744e-05,-2.6575e-05,2.4604e-05,7.8777e-06,-2.9356e-06,-3.5984e-06,3.5428e-05,-1.2809e-05,3.3021e-06,9.6301e-06,7.8777e-06,1.7504e-05,-2.0195e-06,1.0349e-06,-6.5855e-06,-6.9363e-06,9.6301e-06,2.9597e-05,-3.2548e-06,-1.4493e-06,5.2577e-06,1.8035e-06,-6.9363e-06,2.1371e-05,3.4386e-06,1.8872e-05,-2.0093e-07,-1.8087e-05,1.8035e-06,1.0261e-05,1.0837e-05,8.4982e-06,1.0201e-05,8.4982e-06,1.0505e-05,8.4903e-06,3.6806e-05,8.4903e-06,1.1842e-05,8.4982e-06,-7.5356e-07,8.4982e-06,1.4297e-05,2.1783e-05,-2.1783e-05,-2.5727e-05,2.5727e-05,2.8483e-06,-2.8483e-06,-2.7116e-06,2.7116e-06,-1.2874e-05,1.2874e-05,-1.3761e-05,1.3761e-05}
>>>> Re-trying (2/3).
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9796e+00,-1.5144e+00,-1.2856e+00,-1.4063e+00,-1.0056e+00,-1.4029e+00,-1.6061e+00,-6.4255e-03,-2.4039e+00,-1.2856e+00,-2.4039e+00,-8.8852e-01,-2.8600e+00,-2.8687e+00,-1.1652e+00,-2.4039e+00,1.7757e+00,-3.9011e+00,-3.9875e+00,-3.4711e+00,-2.8370e+00,-1.1652e+00,8.4212e-01,-8.0437e-01,-4.0574e+00,-1.6088e-01,-3.5159e+00,-2.8370e+00,-7.4907e-01,-1.0271e-01,-5.5169e-01,-2.4560e+00,-4.2469e-01,-3.5159e+00,-2.0157e+00,-2.4590e+00,4.2491e+00,5.1003e+00,4.2491e+00,5.2527e+00,4.2452e+00,4.4180e+00,4.2452e+00,4.6563e+00,4.2491e+00,2.2628e+00,4.2491e+00,2.4645e+00,5.4284e-01,-5.4284e-01,5.8617e-01,-5.8617e-01,9.7673e-02,-9.7673e-02,1.8992e-01,-1.8992e-01,3.8354e-01,-3.8354e-01,3.8442e-01,-3.8442e-01}
> Gradient:  {-1.3719e-06,5.1561e-07,-2.9356e-06,-6.9677e-06,2.4816e-05,2.0744e-05,-2.6575e-05,2.4604e-05,7.8777e-06,-2.9356e-06,-3.5984e-06,3.5428e-05,-1.2809e-05,3.3021e-06,9.6301e-06,7.8777e-06,1.7504e-05,-2.0195e-06,1.0349e-06,-6.5855e-06,-6.9363e-06,9.6301e-06,2.9597e-05,-3.2548e-06,-1.4493e-06,5.2577e-06,1.8035e-06,-6.9363e-06,2.1371e-05,3.4386e-06,1.8872e-05,-2.0093e-07,-1.8087e-05,1.8035e-06,1.0261e-05,1.0837e-05,8.4982e-06,1.0201e-05,8.4982e-06,1.0505e-05,8.4903e-06,3.6806e-05,8.4903e-06,1.1842e-05,8.4982e-06,-7.5356e-07,8.4982e-06,1.4297e-05,2.1783e-05,-2.1783e-05,-2.5820e-05,2.5820e-05,2.8483e-06,-2.8483e-06,-2.7116e-06,2.7116e-06,-1.2874e-05,1.2874e-05,-1.3761e-05,1.3761e-05}
>>>> Re-trying (3/3).
After: gradient norm = 1.1089519230861222E-4
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5862,-0.5862}

Count Table 2:
---------------
h:                 {0.0977,-0.0977}

Count Table 3:
---------------
h:                 {0.1899,-0.1899}

Count Table 4:
---------------
h:                 {0.3835,-0.3835}

Count Table 5:
---------------
h:                 {0.3844,-0.3844}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-1.5144,-1.9796,-1.4029,-1.0056,-1.2856,-1.4063,-0.0064,-1.6061,-0.8885,-2.4039,-2.4039,-1.2856,-2.8687,-2.8600,-3.9011,1.7757,-1.1652,-2.4039,-3.4711,-3.9875,-0.8044,0.8421,-2.8370,-1.1652,-0.1609,-4.0574,-0.1027,-0.7491,-3.5159,-2.8370,-2.4560,-0.5517,-2.4590,-2.0157,-0.4247,-3.5159,-2.0157,-2.4590,-0.5517,-2.4560,-3.5159,-0.4247,-0.7491,-0.1027,-4.0574,-0.1609,-2.8370,-3.5159,0.8421,-0.8044,-3.9875,-3.4711,-1.1652,-2.8370,1.7757,-3.9011,-2.8600,-2.8687,-2.4039,-1.1652,-2.4039,-0.8885,-1.6061,-0.0064,-1.2856,-2.4039,-1.0056,-1.4029,-1.9796,-1.5144,-1.4063,-1.2856}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {4.2491,5.1003}
Activity(exp=1):   {4.2491,5.2527}
Activity(exp=2):   {4.2452,4.4180}
Activity(exp=3):   {4.2452,4.6563}
Activity(exp=4):   {4.2491,2.2628}
Activity(exp=5):   {4.2491,2.4645}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

Suggested variations:
key=12;3;0, description = Initial model.
> Optimizing variation "Initial model." (component2-2-variation0).
>>  Starting new optimization: component2-2-variation0. (2021-05-21 18:14:03.652).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.674216846081103
gradient      = {-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 1.1089519230861225E-4
Starting Function Value: 3.674216846081103
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.674216807290734    0.000696836961700    6.283743660956771    0.000131439046231
         2            4    3.674216766747938    0.000537721931271    1.000000000000000    0.000109178856620
         3            7    3.674216632216953    0.002335952895166    0.660000000000000    0.000111107051658
         4            8    3.674216443589388    0.006146448937992    1.000000000000000    0.000228127176371
         5            9    3.674216260597036    0.006563228658028    1.000000000000000    0.000244678829535
         6           10    3.674216020287787    0.001572732419983    1.000000000000000    0.000125235024878
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9784e+00,-1.5136e+00,-1.2848e+00,-1.4045e+00,-1.0095e+00,-1.4046e+00,-1.5993e+00,-9.3506e-03,-2.4058e+00,-1.2848e+00,-2.4027e+00,-8.9345e-01,-2.8568e+00,-2.8694e+00,-1.1674e+00,-2.4058e+00,1.7786e+00,-3.9005e+00,-3.9876e+00,-3.4695e+00,-2.8354e+00,-1.1674e+00,8.4038e-01,-8.0180e-01,-4.0570e+00,-1.5971e-01,-3.5163e+00,-2.8354e+00,-7.5246e-01,-1.0045e-01,-5.5242e-01,-2.4552e+00,-4.2014e-01,-3.5163e+00,-2.0168e+00,-2.4604e+00,4.2471e+00,5.0978e+00,4.2471e+00,5.2502e+00,4.2431e+00,4.4111e+00,4.2431e+00,4.6550e+00,4.2471e+00,2.2630e+00,4.2471e+00,2.4612e+00,5.4281e-01,-5.4281e-01,5.8617e-01,-5.8617e-01,9.7460e-02,-9.7460e-02,1.8990e-01,-1.8990e-01,3.8350e-01,-3.8350e-01,3.8436e-01,-3.8436e-01}
> Gradient:  {-1.8734e-06,3.2918e-06,2.7577e-06,-3.7036e-06,-7.8713e-06,-1.6569e-05,2.6188e-06,-1.0712e-05,7.8528e-06,2.7577e-06,-8.0042e-08,-2.6405e-05,-1.4017e-05,2.0399e-06,8.7910e-06,7.8528e-06,-3.7267e-05,-2.6713e-06,3.5670e-07,-5.7043e-06,-6.8426e-06,8.7910e-06,-2.5821e-05,-6.0513e-06,-2.2814e-06,-9.2721e-06,1.7175e-06,-6.8426e-06,-9.5873e-06,-9.0053e-06,-4.3992e-05,-9.3427e-06,3.7552e-05,1.7175e-06,-1.0889e-05,-1.0317e-05,8.4941e-06,1.0196e-05,8.4941e-06,1.0500e-05,8.4862e-06,-4.1617e-06,8.4862e-06,2.3770e-05,8.4941e-06,-9.5269e-07,8.4941e-06,1.4132e-05,9.2353e-06,-9.2353e-06,-2.7299e-05,2.7299e-05,-1.1495e-05,1.1495e-05,-1.6454e-05,1.6454e-05,-2.6271e-05,2.6271e-05,-3.5950e-05,3.5950e-05}
>>>> Re-trying (1/3).
Starting Function Value: 3.674216165036283
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.674216122990435    0.000668092615220    5.333301423029973    0.000118406742848
         2            4    3.674216088531880    0.000464532058956    1.000000000000000    0.000093905679408
         3            5    3.674215984999164    0.002288877941288    1.000000000000000    0.000113988806811
         4            6    3.674215897197922    0.002907868617099    1.000000000000000    0.000187296305217
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9785e+00,-1.5142e+00,-1.2850e+00,-1.4042e+00,-1.0093e+00,-1.4041e+00,-1.5998e+00,-9.2075e-03,-2.4064e+00,-1.2850e+00,-2.4028e+00,-8.9217e-01,-2.8556e+00,-2.8696e+00,-1.1682e+00,-2.4064e+00,1.7796e+00,-3.9003e+00,-3.9877e+00,-3.4690e+00,-2.8348e+00,-1.1682e+00,8.4105e-01,-8.0187e-01,-4.0568e+00,-1.5965e-01,-3.5165e+00,-2.8348e+00,-7.5203e-01,-1.0066e-01,-5.5000e-01,-2.4546e+00,-4.2317e-01,-3.5165e+00,-2.0163e+00,-2.4599e+00,4.2464e+00,5.0970e+00,4.2464e+00,5.2493e+00,4.2424e+00,4.4108e+00,4.2424e+00,4.6526e+00,4.2464e+00,2.2631e+00,4.2464e+00,2.4600e+00,5.4284e-01,-5.4284e-01,5.8601e-01,-5.8601e-01,9.7615e-02,-9.7615e-02,1.8999e-01,-1.8999e-01,3.8361e-01,-3.8361e-01,3.8453e-01,-3.8453e-01}
> Gradient:  {1.0651e-05,1.2957e-05,2.2870e-06,-2.9575e-06,1.2879e-05,2.5887e-05,1.1635e-05,1.8741e-05,7.6918e-06,2.2870e-06,3.1647e-06,1.8183e-05,-1.3116e-05,1.1503e-06,7.6448e-06,7.6918e-06,5.0178e-05,-3.1464e-06,8.0070e-07,-5.3888e-06,-6.8418e-06,7.6448e-06,3.6450e-05,1.7737e-05,-1.7887e-06,2.0802e-05,1.7761e-06,-6.8418e-06,6.5214e-06,2.9933e-05,2.8459e-05,3.1877e-06,2.2847e-06,1.7761e-06,9.4077e-06,5.2869e-06,8.4927e-06,1.0194e-05,8.4927e-06,1.0499e-05,8.4848e-06,3.3707e-05,8.4848e-06,2.8491e-05,8.4927e-06,-5.4208e-07,8.4927e-06,1.3959e-05,2.1089e-05,-2.1089e-05,-1.0145e-04,1.0145e-04,-1.1971e-05,1.1971e-05,8.3335e-07,-8.3335e-07,1.1294e-05,-1.1294e-05,2.5362e-05,-2.5362e-05}
>>>> Re-trying (2/3).
Starting Function Value: 3.674217131048808
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            6    3.674215870308422    0.000254436703043    1.357541834122882    0.000104948270800
         2            7    3.674215851959819    0.000411365747180    1.000000000000000    0.000065870751261
Gradient   = {5.3046e-06,6.4731e-06,1.1282e-06,-3.9814e-06,3.2085e-06,8.3472e-06,5.3076e-06,3.3460e-06,7.6635e-06,1.1282e-06,6.8391e-07,2.3510e-06,-1.3673e-05,7.0974e-07,7.4355e-06,7.6635e-06,1.0410e-05,-3.3656e-06,4.6943e-07,-6.0288e-06,-6.8585e-06,7.4355e-06,8.1085e-06,6.0541e-06,-2.1760e-06,6.5432e-06,1.7529e-06,-6.8585e-06,-9.9514e-07,1.0914e-05,1.0876e-05,-7.9816e-07,-5.7881e-06,1.7529e-06,2.8753e-06,2.6233e-07,8.4926e-06,1.0194e-05,8.4926e-06,1.0498e-05,8.4847e-06,2.4756e-05,8.4847e-06,1.6924e-05,8.4926e-06,-5.8751e-07,8.4926e-06,1.3912e-05,-4.6085e-06,4.6085e-06,2.1585e-05,-2.1585e-05,8.0484e-06,-8.0484e-06,8.3814e-06,-8.3814e-06,-1.8948e-06,1.8948e-06,-3.6541e-06,3.6541e-06}
pCurr      = {-3.7075e-05,-4.5189e-05,-7.9133e-06,2.1699e-05,-3.0251e-05,-6.9455e-05,-3.8287e-05,-3.8019e-05,-4.4198e-05,-7.9133e-06,-6.9494e-06,-3.2817e-05,7.8132e-05,-4.6104e-06,-4.3101e-05,-4.4198e-05,-1.0842e-04,1.9140e-05,-3.1001e-06,3.3979e-05,3.9506e-05,-4.3101e-05,-8.1248e-05,-4.9097e-05,1.2077e-05,-5.5055e-05,-1.0130e-05,3.9506e-05,-3.3839e-06,-8.6076e-05,-8.4105e-05,-2.3444e-07,2.3533e-05,-1.0130e-05,-2.4513e-05,-7.6122e-06,-4.8943e-05,-5.8747e-05,-4.8943e-05,-6.0502e-05,-4.8897e-05,-1.5354e-04,-4.8897e-05,-1.1159e-04,-4.8943e-05,3.3257e-06,-4.8943e-05,-8.0249e-05,-2.0802e-06,2.0802e-06,1.1411e-05,-1.1411e-05,-2.5133e-05,2.5133e-05,-4.1170e-05,4.1170e-05,-4.3310e-06,4.3310e-06,-1.2991e-05,1.2991e-05}
grad*pCur  = -2.0457153661297655E-8
parameters = {-1.9786e+00,-1.5142e+00,-1.2850e+00,-1.4042e+00,-1.0094e+00,-1.4042e+00,-1.5998e+00,-9.2879e-03,-2.4064e+00,-1.2850e+00,-2.4028e+00,-8.9225e-01,-2.8555e+00,-2.8696e+00,-1.1682e+00,-2.4064e+00,1.7794e+00,-3.9003e+00,-3.9877e+00,-3.4690e+00,-2.8348e+00,-1.1682e+00,8.4090e-01,-8.0195e-01,-4.0568e+00,-1.5975e-01,-3.5165e+00,-2.8348e+00,-7.5206e-01,-1.0080e-01,-5.5013e-01,-2.4547e+00,-4.2317e-01,-3.5165e+00,-2.0163e+00,-2.4599e+00,4.2463e+00,5.0969e+00,4.2463e+00,5.2492e+00,4.2424e+00,4.4107e+00,4.2424e+00,4.6525e+00,4.2463e+00,2.2631e+00,4.2463e+00,2.4599e+00,5.4278e-01,-5.4278e-01,5.8627e-01,-5.8627e-01,9.7624e-02,-9.7624e-02,1.8995e-01,-1.8995e-01,3.8357e-01,-3.8357e-01,3.8445e-01,-3.8445e-01}
|grad|/|x| = 3.323851959053614E-6
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9786e+00,-1.5142e+00,-1.2850e+00,-1.4042e+00,-1.0094e+00,-1.4042e+00,-1.5998e+00,-9.2878e-03,-2.4064e+00,-1.2850e+00,-2.4028e+00,-8.9225e-01,-2.8555e+00,-2.8696e+00,-1.1682e+00,-2.4064e+00,1.7794e+00,-3.9003e+00,-3.9877e+00,-3.4690e+00,-2.8348e+00,-1.1682e+00,8.4090e-01,-8.0195e-01,-4.0568e+00,-1.5975e-01,-3.5165e+00,-2.8348e+00,-7.5206e-01,-1.0080e-01,-5.5013e-01,-2.4547e+00,-4.2317e-01,-3.5165e+00,-2.0163e+00,-2.4599e+00,4.2463e+00,5.0969e+00,4.2463e+00,5.2492e+00,4.2424e+00,4.4107e+00,4.2424e+00,4.6525e+00,4.2463e+00,2.2631e+00,4.2463e+00,2.4599e+00,5.4278e-01,-5.4278e-01,5.8627e-01,-5.8627e-01,9.7625e-02,-9.7625e-02,1.8995e-01,-1.8995e-01,3.8357e-01,-3.8357e-01,3.8445e-01,-3.8445e-01}
> Gradient:  {5.3046e-06,6.4731e-06,1.1282e-06,-3.9814e-06,3.2085e-06,8.3472e-06,5.3076e-06,3.3460e-06,7.6635e-06,1.1282e-06,6.8391e-07,2.3510e-06,-1.3673e-05,7.0974e-07,7.4355e-06,7.6635e-06,1.0410e-05,-3.3656e-06,4.6943e-07,-6.0288e-06,-6.8585e-06,7.4355e-06,8.1085e-06,6.0541e-06,-2.1760e-06,6.5432e-06,1.7529e-06,-6.8585e-06,-9.9514e-07,1.0914e-05,1.0876e-05,-7.9816e-07,-5.7881e-06,1.7529e-06,2.8753e-06,2.6233e-07,8.4926e-06,1.0194e-05,8.4926e-06,1.0498e-05,8.4847e-06,2.4756e-05,8.4847e-06,1.6924e-05,8.4926e-06,-5.8751e-07,8.4926e-06,1.3912e-05,-4.6085e-06,4.6085e-06,2.1585e-05,-2.1585e-05,8.0484e-06,-8.0484e-06,8.3814e-06,-8.3814e-06,-1.8948e-06,1.8948e-06,-3.6541e-06,3.6541e-06}
>>>> Re-trying (3/3).
After: gradient norm = 6.583704399205123E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5863,-0.5863}

Count Table 2:
---------------
h:                 {0.0976,-0.0976}

Count Table 3:
---------------
h:                 {0.1900,-0.1900}

Count Table 4:
---------------
h:                 {0.3836,-0.3836}

Count Table 5:
---------------
h:                 {0.3844,-0.3844}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-1.5142,-1.9786,-1.4042,-1.0094,-1.2850,-1.4042,-0.0093,-1.5998,-0.8922,-2.4028,-2.4064,-1.2850,-2.8696,-2.8555,-3.9003,1.7794,-1.1682,-2.4064,-3.4690,-3.9877,-0.8019,0.8409,-2.8348,-1.1682,-0.1597,-4.0568,-0.1008,-0.7521,-3.5165,-2.8348,-2.4547,-0.5501,-2.4599,-2.0163,-0.4232,-3.5165,-2.0163,-2.4599,-0.5501,-2.4547,-3.5165,-0.4232,-0.7521,-0.1008,-4.0568,-0.1597,-2.8348,-3.5165,0.8409,-0.8019,-3.9877,-3.4690,-1.1682,-2.8348,1.7794,-3.9003,-2.8555,-2.8696,-2.4064,-1.1682,-2.4028,-0.8922,-1.5998,-0.0093,-1.2850,-2.4064,-1.0094,-1.4042,-1.9786,-1.5142,-1.4042,-1.2850}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {4.2463,5.0969}
Activity(exp=1):   {4.2463,5.2492}
Activity(exp=2):   {4.2424,4.4107}
Activity(exp=3):   {4.2424,4.6525}
Activity(exp=4):   {4.2463,2.2631}
Activity(exp=5):   {4.2463,2.4599}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;4;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component2-2-variation1).
>>  Starting new optimization: component2-2-variation1. (2021-05-21 18:15:21.937).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.6742123961115865
gradient      = {0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 6.409487664000965E-5
Starting Function Value: 3.6742123961115865
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            6    3.674212383264353    0.000169001912530    2.636746045693795    0.000049632705996
         2            7    3.674212368046645    0.000406843608828    1.000000000000000    0.000072904289578
         3            8    3.674212322414391    0.001493646718351    1.000000000000000    0.000145358407549
         4            9    3.674212232382373    0.003295165098166    1.000000000000000    0.000228441791064
         5           10    3.674212013646268    0.008578112039728    1.000000000000000    0.000337992074581
         6           11    3.674211592346059    0.017923860817281    1.000000000000000    0.000429931984960
         7           12    3.674210956529429    0.031709123879467    1.000000000000000    0.000483773557060
         8           13    3.674210099576291    0.058681665967310    1.000000000000000    0.000384065254041
         9           14    3.674209201007574    0.020444473270603    1.000000000000000    0.000253569713264
        10           15    3.674208128928137    0.031269387970991    1.000000000000000    0.000509467003117
        11           16    3.674207485235665    0.024896504245078    1.000000000000000    0.000621483690275
        12           17    3.674206455456199    0.045825172322999    1.000000000000000    0.000514333197055
        13           18    3.674206158907713    0.069603882747092    1.000000000000000    0.000857375569580
        14           19    3.674205274891067    0.003645758656619    1.000000000000000    0.000244420625400
        15           20    3.674205076718566    0.001730517530246    1.000000000000000    0.000244933144857
        16           21    3.674204466192347    0.017042413431650    1.000000000000000    0.000405244105536
        17           22    3.674203460488525    0.040157961518116    1.000000000000000    0.000563335058005
        18           23    3.674203003497718    0.089129121103565    1.000000000000000    0.000992488229941
        19           24    3.674201633259614    0.022896931041351    1.000000000000000    0.000368816765529
        20           25    3.674201330917643    0.005188785069639    1.000000000000000    0.000172022835998
        21           26    3.674201216637008    0.008293980930387    1.000000000000000    0.000132572595252
        22           27    3.674201111128956    0.006349064168759    1.000000000000000    0.000178547473539
        23           28    3.674200792869703    0.018758249597544    1.000000000000000    0.000331449597487
        24           29    3.674200130505514    0.035936487290230    1.000000000000000    0.000518559806647
        25           30    3.674199085424048    0.058410820789656    1.000000000000000    0.000577065968705
        26           32    3.674198523278290    0.040297082038236    0.477130821773989    0.000732725102708
        27           33    3.674197653186909    0.031440364966780    1.000000000000000    0.000367329046474
        28           34    3.674197056892928    0.013970070132422    1.000000000000000    0.000234134990291
        29           35    3.674196658134758    0.007874819519971    1.000000000000000    0.000380595206559
        30           36    3.674195723680447    0.027304271522007    1.000000000000000    0.000628327110737
        31           37    3.674194303573062    0.069105383713618    1.000000000000000    0.000790802886768
        32           38    3.674191865789224    0.128582015322736    1.000000000000000    0.000653930209454
        33           39    3.674188740660717    0.161976542760203    1.000000000000000    0.000354024846300
        34           40    3.674185510637667    0.198569774391485    1.000000000000000    0.000433528069226
        35           41    3.674183286638322    0.114993579815063    1.000000000000000    0.000725641588216
        36           42    3.674180662446046    0.111089204579806    1.000000000000000    0.000792705364829
        37           43    3.674176852642946    0.231263666708222    1.000000000000000    0.000812745897708
        38           44    3.674173784839547    0.092532916360249    1.000000000000000    0.000482174667743
        39           46    3.674173126089075    0.021284875165665    0.260100461651495    0.000417858998798
        40           47    3.674171146462737    0.082245227692484    1.000000000000000    0.000413645843115
        41           48    3.674170392266306    0.042322281539576    1.000000000000000    0.000382500192937
        42           49    3.674167717077284    0.145032886333406    1.000000000000000    0.000348789017102
        43           50    3.674165689049699    0.126184233215555    1.000000000000000    0.000526852560592
        44           51    3.674163321906042    0.127221140096000    1.000000000000000    0.000689055791686
        45           53    3.674162833014363    0.018895042218506    0.167656477153609    0.000660193597677
        46           54    3.674158877006644    0.180203026930281    1.000000000000000    0.000253770788639
        47           55    3.674158165362187    0.049331256795405    1.000000000000000    0.000268672477776
        48           56    3.674156579805403    0.077598583155095    1.000000000000000    0.000585891588575
        49           57    3.674154864184421    0.088173046830926    1.000000000000000    0.000802664613943
        50           58    3.674152268487422    0.150410957775992    1.000000000000000    0.000774698205014
        51           59    3.674148198601622    0.230049552969571    1.000000000000000    0.000471086973913
        52           60    3.674143003685050    0.359234651867660    1.000000000000000    0.000364423061000
        53           61    3.674140479719026    0.165020537413098    1.000000000000000    0.000681171940711
        54           62    3.674137500099288    0.173561627161661    1.000000000000000    0.000793125410626
        55           63    3.674132127232114    0.299956786532576    1.000000000000000    0.000600011760619
        56           64    3.674123690028403    0.534167702583246    1.000000000000000    0.000247702205155
        57           65    3.674119698192627    0.300584307559565    1.000000000000000    0.000509589123969
        58           66    3.674115380109640    0.251513815352653    1.000000000000000    0.000732781013273
        59           67    3.674108197387890    0.431582269697708    1.000000000000000    0.000801824195272
        60           68    3.674088984426830    1.257314502692329    1.000000000000000    0.001319362180023
        61           69    3.674069155206268    1.299260184120131    1.000000000000000    0.000627032246743
        62           70    3.674054600595934    0.951656517023677    1.000000000000000    0.000416303252345
        63           71    3.674046293384731    0.452713146329776    1.000000000000000    0.000497764792125
        64           72    3.674038915702010    0.668135302025027    1.000000000000000    0.000527267808760
        65           73    3.674026211749762    0.872898126772549    1.000000000000000    0.001010896739031
        66           74    3.674021806193902    0.226509029345721    1.000000000000000    0.000246012928509
        67           75    3.674019341766160    0.099485462035625    1.000000000000000    0.000170096106297
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.1918e+00,-1.7359e+00,-1.3743e+00,-1.6449e+00,-1.2309e+00,-1.6190e+00,-1.5752e+00,3.1054e-02,-3.6528e+00,-1.3743e+00,-2.3678e+00,-8.5779e-01,-2.0461e+00,-2.1167e+00,-7.0783e-01,-3.6528e+00,2.5797e+00,-3.2376e+00,-3.7775e+00,-3.3005e+00,-2.0075e+00,-7.0783e-01,1.1318e+00,-5.1973e-01,-3.6177e+00,2.1291e-01,-3.6688e+00,-2.0075e+00,-3.7548e-01,2.7521e-01,-7.0621e-02,-1.9896e+00,7.0174e-02,-3.6688e+00,-1.5424e+00,-1.9801e+00,1.5894e+00,1.9077e+00,1.5894e+00,1.9647e+00,1.5879e+00,9.0573e-01,1.5879e+00,1.1311e+00,1.5894e+00,-1.6531e+00,1.5894e+00,-1.2113e+00,5.4283e-01,-5.4283e-01,5.8622e-01,-5.8622e-01,9.7435e-02,-9.7435e-02,1.8902e-01,-1.8902e-01,3.8286e-01,-3.8286e-01,3.8371e-01,-3.8371e-01}
> Gradient:  {3.5209e-05,5.1986e-06,-5.3152e-07,-3.2636e-05,-5.7277e-05,7.6790e-06,-2.2682e-05,1.4497e-05,-1.4814e-05,-5.3152e-07,1.6688e-05,-3.5516e-05,7.6393e-06,4.5419e-06,-1.9646e-05,-1.4814e-05,2.9774e-06,-2.0594e-05,-1.0430e-05,-4.6451e-05,4.2883e-05,-1.9646e-05,7.7585e-06,-1.4009e-05,2.7379e-05,-5.3066e-05,-1.0562e-05,4.2883e-05,-6.4171e-07,-4.5888e-05,-2.1248e-05,-2.2399e-05,1.3715e-05,-1.0562e-05,3.4612e-06,-2.8626e-06,3.1787e-06,3.8155e-06,3.1787e-06,3.9295e-06,3.1757e-06,5.1169e-05,3.1757e-06,-1.2344e-05,3.1787e-06,-2.4913e-05,3.1787e-06,-1.7152e-05,2.0841e-05,-2.0841e-05,-7.3765e-07,7.3765e-07,-1.9709e-05,1.9709e-05,3.6472e-06,-3.6472e-06,1.5132e-05,-1.5132e-05,-6.3321e-06,6.3321e-06}
>>>> Re-trying (1/3).
Starting Function Value: 3.6740206547140857
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.674020301821916    0.004112455568270   24.196012602703470    0.000483665116969
         2            4    3.674019721105887    0.003960130809306    1.000000000000000    0.000423192977771
         3            5    3.674016609899626    0.037771466774084    1.000000000000000    0.000463316193338
         4            7    3.674016097201097    0.008204730733364    0.266199165765256    0.000370046284840
         5            8    3.674015737157168    0.007162462349166    1.000000000000000    0.000243538538626
         6            9    3.674015312761342    0.007351820308777    1.000000000000000    0.000230709513420
         7           10    3.674014718455892    0.011009476056671    1.000000000000000    0.000409014828638
         8           11    3.674013662229451    0.016228289684813    1.000000000000000    0.000560569427602
         9           12    3.674010428344072    0.055813167729234    1.000000000000000    0.000840948295345
        10           14    3.674009321584946    0.027918274749226    0.285129350868312    0.001012821019838
        11           15    3.674006868344484    0.041032567883725    1.000000000000000    0.000582783677912
        12           16    3.674005658273461    0.018845925308767    1.000000000000000    0.000292467239930
        13           17    3.674005290787755    0.006158231739641    1.000000000000000    0.000366194977538
        14           18    3.674004581468679    0.003993916945439    1.000000000000000    0.000406066612791
        15           19    3.674002563240400    0.022611840374444    1.000000000000000    0.000584453537535
        16           20    3.674000388998962    0.045732188345239    1.000000000000000    0.000661774771441
        17           22    3.673999979106681    0.007944304496597    0.087527198044793    0.000539767349496
        18           24    3.673999797935661    0.004300559351490    0.092711336040300    0.000503269922663
        19           25    3.673998238608521    0.056123811898139    1.000000000000000    0.000211247898847
        20           26    3.673997873202462    0.011150157397140    1.000000000000000    0.000249919561251
        21           27    3.673996162057740    0.047775396271205    1.000000000000000    0.000432347699943
        22           28    3.673994792456788    0.031682636259877    1.000000000000000    0.000379206252044
        23           29    3.673992907913702    0.043478492469874    1.000000000000000    0.000241135772568
        24           30    3.673991622774882    0.030033610289567    1.000000000000000    0.000167171093590
        25           31    3.673990802237752    0.022344430400761    1.000000000000000    0.000246821237006
        26           32    3.673990075453377    0.020265939603720    1.000000000000000    0.000295156524302
        27           33    3.673988471812492    0.041942583524328    1.000000000000000    0.000325790448567
        28           34    3.673987824161572    0.041994828885606    1.000000000000000    0.000157326521100
        29           36    3.673987774342863    0.001612298034664    0.048121480237838    0.000155903224813
        30           37    3.673986104527560    0.067116337578719    1.000000000000000    0.000285951936174
        31           38    3.673985229088740    0.031997690334132    1.000000000000000    0.000297886157315
        32           39    3.673982712335255    0.092026468056428    1.000000000000000    0.000247813406873
        33           40    3.673981304369826    0.060818249414699    1.000000000000000    0.000243786871324
        34           41    3.673980574310482    0.025398426963275    1.000000000000000    0.000194645089565
        35           42    3.673980040355599    0.016480396099697    1.000000000000000    0.000200635442360
        36           43    3.673979157982387    0.032296581182960    1.000000000000000    0.000147001482760
        37           44    3.673977984711249    0.063517465809193    1.000000000000000    0.000127670586393
        38           45    3.673977076447013    0.047140007731631    1.000000000000000    0.000192161846105
        39           47    3.673976937470577    0.014791335144441    0.215157039614234    0.000193212729889
        40           48    3.673974647402722    0.118895464327745    1.000000000000000    0.000187186005850
        41           49    3.673973500274302    0.074435135020082    1.000000000000000    0.000341546253937
        42           50    3.673972663438093    0.045746050889527    1.000000000000000    0.000197596636129
        43           51    3.673972302327912    0.013848279361447    1.000000000000000    0.000079863116970
        44           52    3.673972118043592    0.009394202654277    1.000000000000000    0.000091973241817
        45           54    3.673972073862528    0.000326259967456    0.029129738148288    0.000093473930531
        46           55    3.673971322720803    0.039678386997453    1.000000000000000    0.000234717829167
        47           56    3.673970827078153    0.034594990345683    1.000000000000000    0.000248243981226
        48           57    3.673969293470005    0.103369586710547    1.000000000000000    0.000197547197283
        49           58    3.673967534011505    0.146631313603446    1.000000000000000    0.000172767120230
        50           59    3.673966341565410    0.115970752206866    1.000000000000000    0.000185035949191
        51           60    3.673965668205502    0.038286982255307    1.000000000000000    0.000148654487411
        52           61    3.673964993955925    0.034640022936971    1.000000000000000    0.000143921290281
        53           62    3.673963701847578    0.062847706920324    1.000000000000000    0.000162755441689
        54           63    3.673960636228239    0.210249201618678    1.000000000000000    0.000177504738330
        55           64    3.673957655121555    0.234808950389627    1.000000000000000    0.000287702995342
        56           65    3.673954153997042    0.292923522778363    1.000000000000000    0.000201073688719
        57           66    3.673951532041472    0.132887407489219    1.000000000000000    0.000183983885521
        58           67    3.673948624834301    0.122523798465891    1.000000000000000    0.000158638256307
        59           69    3.673948593127416    0.005454204337912    0.085874751538938    0.000153698931353
        60           70    3.673946071510354    0.115950103772531    1.000000000000000    0.000090429280051
        61           71    3.673945374051311    0.024943049109320    1.000000000000000    0.000078275678976
        62           72    3.673943407906943    0.106971364110550    1.000000000000000    0.000222086507113
        63           73    3.673942167257746    0.068617567310547    1.000000000000000    0.000213915399024
        64           74    3.673940689803333    0.109742156281451    1.000000000000000    0.000139939251357
        65           75    3.673939598987275    0.054987748191522    1.000000000000000    0.000074737917764
        66           76    3.673939229557438    0.025451911987107    1.000000000000000    0.000098989205834
        67           77    3.673938949135958    0.019281528327748    1.000000000000000    0.000112752777033
        68           78    3.673938421591652    0.041947639372159    1.000000000000000    0.000098713249656
        69           79    3.673938141048263    0.030015043837483    1.000000000000000    0.000049690005893
        70           80    3.673938026761893    0.013048634579534    1.000000000000000    0.000044172241366
        71           81    3.673937923549558    0.009990796291387    1.000000000000000    0.000068328292038
        72           82    3.673937714252330    0.020044663963973    1.000000000000000    0.000102746757241
        73           83    3.673937262007029    0.043107705896152    1.000000000000000    0.000139912098384
        74           84    3.673936680560966    0.073356395693127    1.000000000000000    0.000129923127241
        75           85    3.673936131293609    0.085889213523200    1.000000000000000    0.000154982087162
        76           86    3.673935839826374    0.064675162633870    1.000000000000000    0.000057547894774
        77           87    3.673935656782385    0.021922045793090    1.000000000000000    0.000080735149705
        78           88    3.673935515032480    0.013017246293690    1.000000000000000    0.000087607619909
        79           89    3.673935163176676    0.043561371582607    1.000000000000000    0.000144397093877
        80           90    3.673934647195735    0.075344986622103    1.000000000000000    0.000177411099576
        81           91    3.673934075828298    0.101789281269588    1.000000000000000    0.000126705205005
        82           92    3.673933702044373    0.074208872406851    1.000000000000000    0.000053356856360
        83           93    3.673933367410177    0.023118992403289    1.000000000000000    0.000040060939566
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9796e+00,-1.5150e+00,-1.3093e+00,-1.3980e+00,-1.0098e+00,-1.4045e+00,-1.6455e+00,-5.7643e-02,-2.2199e+00,-1.3093e+00,-2.4440e+00,-9.3972e-01,-2.2162e+00,-2.2839e+00,-6.6402e-01,-2.2199e+00,2.3687e+00,-3.2877e+00,-3.4715e+00,-2.9824e+00,-2.1730e+00,-6.6402e-01,1.3139e+00,-3.2614e-01,-3.5453e+00,3.5386e-01,-3.1121e+00,-2.1730e+00,-2.3880e-01,4.1230e-01,-9.6516e-03,-1.9111e+00,1.1853e-01,-3.1121e+00,-1.4720e+00,-1.9167e+00,1.1631e+00,1.3961e+00,1.1631e+00,1.4378e+00,1.1620e+00,2.6392e-01,1.1620e+00,5.0735e-01,1.1631e+00,-1.6750e+00,1.1631e+00,-1.6756e+00,5.4280e-01,-5.4280e-01,5.8620e-01,-5.8620e-01,9.7696e-02,-9.7696e-02,1.9009e-01,-1.9009e-01,3.8410e-01,-3.8410e-01,3.8450e-01,-3.8450e-01}
> Gradient:  {-2.9772e-06,3.4723e-06,-3.6601e-07,1.9813e-07,3.7524e-06,3.1173e-06,1.9607e-06,6.4435e-07,3.9657e-06,-3.6601e-07,-8.1958e-07,1.8117e-06,9.8072e-06,-3.9189e-06,-3.3363e-06,3.9657e-06,4.2149e-06,-2.2832e-06,1.0747e-05,-1.9830e-06,4.7476e-06,-3.3363e-06,-2.0279e-06,3.0177e-07,-2.6981e-06,1.8586e-06,-6.7394e-07,4.7476e-06,-2.0722e-06,7.2875e-06,6.2951e-06,-3.5563e-06,1.6586e-06,-6.7394e-07,2.3563e-06,2.3698e-06,2.3262e-06,2.7922e-06,2.3262e-06,2.8756e-06,2.3240e-06,2.7082e-06,2.3240e-06,-3.1601e-06,2.3262e-06,9.6967e-06,2.3262e-06,6.4270e-06,6.6626e-06,-6.6626e-06,-1.2143e-05,1.2143e-05,-7.7440e-06,7.7440e-06,1.1325e-05,-1.1325e-05,3.9023e-06,-3.9023e-06,-5.7328e-06,5.7328e-06}
>>>> Re-trying (2/3).
Starting Function Value: 3.6739335945078397
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673933563650904    0.000163055928178    4.072147059511531    0.000035757957593
         2            4    3.673933560774734    0.000111050722021    1.000000000000000    0.000034615301195
         3            5    3.673933434374991    0.004110889662040    1.000000000000000    0.000092355757160
         4            6    3.673933432867243    0.005963921626921    1.000000000000000    0.000196983255091
         5            7    3.673933358191955    0.004189417904829    1.000000000000000    0.000139622891920
         6            8    3.673932398842344    0.008995965367256    1.000000000000000    0.000084760251786
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9765e+00,-1.5174e+00,-1.3090e+00,-1.3981e+00,-1.0121e+00,-1.4056e+00,-1.6466e+00,-5.6927e-02,-2.2236e+00,-1.3090e+00,-2.4430e+00,-9.3961e-01,-2.2251e+00,-2.2803e+00,-6.6098e-01,-2.2236e+00,2.3688e+00,-3.2856e+00,-3.4813e+00,-2.9805e+00,-2.1773e+00,-6.6098e-01,1.3183e+00,-3.2499e-01,-3.5428e+00,3.5332e-01,-3.1115e+00,-2.1773e+00,-2.3663e-01,4.0817e-01,-1.2862e-02,-1.9077e+00,1.1720e-01,-3.1115e+00,-1.4735e+00,-1.9184e+00,1.1610e+00,1.3935e+00,1.1610e+00,1.4351e+00,1.1599e+00,2.6314e-01,1.1599e+00,5.1042e-01,1.1610e+00,-1.6840e+00,1.1610e+00,-1.6815e+00,5.4276e-01,-5.4276e-01,5.8622e-01,-5.8622e-01,9.7637e-02,-9.7637e-02,1.9013e-01,-1.9013e-01,3.8409e-01,-3.8409e-01,3.8438e-01,-3.8438e-01}
> Gradient:  {8.9483e-06,-5.1466e-06,3.0911e-06,2.5756e-06,-8.6087e-06,-1.8737e-06,-5.7364e-06,5.4481e-06,3.7846e-06,3.0911e-06,-1.4735e-07,-7.4540e-06,5.0120e-06,-2.5594e-06,-2.2592e-06,3.7846e-06,-1.8069e-06,-1.9371e-06,7.0561e-06,-3.0225e-06,4.4164e-06,-2.2592e-06,9.0717e-06,-1.5029e-05,-1.4239e-06,6.9998e-06,-6.1863e-07,4.4164e-06,1.6517e-05,-2.5657e-05,-2.2915e-05,8.5623e-06,1.6413e-05,-6.1863e-07,-2.1434e-06,9.3582e-07,2.3219e-06,2.7870e-06,2.3219e-06,2.8703e-06,2.3197e-06,-1.7572e-05,2.3197e-06,1.4861e-05,2.3219e-06,8.6224e-06,2.3219e-06,5.6361e-06,-1.2473e-05,1.2473e-05,-3.9609e-06,3.9609e-06,2.9790e-06,-2.9790e-06,-1.0768e-05,1.0768e-05,1.5074e-05,-1.5074e-05,-3.7371e-05,3.7371e-05}
>>>> Re-trying (3/3).
After: gradient norm = 8.480347632413151E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5862,-0.5862}

Count Table 2:
---------------
h:                 {0.0976,-0.0976}

Count Table 3:
---------------
h:                 {0.1901,-0.1901}

Count Table 4:
---------------
h:                 {0.3841,-0.3841}

Count Table 5:
---------------
h:                 {0.3844,-0.3844}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-1.5174,-1.9765,-1.4056,-1.0121,-1.3090,-1.3981,-0.0569,-1.6466,-0.9396,-2.4430,-2.2236,-1.3090,-2.2803,-2.2251,-3.2856,2.3688,-0.6610,-2.2236,-2.9805,-3.4813,-0.3250,1.3183,-2.1773,-0.6610,0.3533,-3.5428,0.4082,-0.2366,-3.1115,-2.1773,-1.9077,-0.0129,-1.9184,-1.4735,0.1172,-3.1115,-1.4735,-1.9184,-0.0129,-1.9077,-3.1115,0.1172,-0.2366,0.4082,-3.5428,0.3533,-2.1773,-3.1115,1.3183,-0.3250,-3.4813,-2.9805,-0.6610,-2.1773,2.3688,-3.2856,-2.2251,-2.2803,-2.2236,-0.6610,-2.4430,-0.9396,-1.6466,-0.0569,-1.3090,-2.2236,-1.0121,-1.4056,-1.9765,-1.5174,-1.3981,-1.3090}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {1.1610,1.3935}
Activity(exp=1):   {1.1610,1.4351}
Activity(exp=2):   {1.1599,0.2631}
Activity(exp=3):   {1.1599,0.5104}
Activity(exp=4):   {1.1610,-1.6840}
Activity(exp=5):   {1.1610,-1.6815}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;5;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component2-2-variation2).
>>  Starting new optimization: component2-2-variation2. (2021-05-21 18:21:34.339).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.676549485697434
gradient      = {0.0080,0.0016,0.0004,0.0004,0.0020,0.0020,0.0078,0.0038,0.0000,0.0004,0.0003,0.0020,0.0001,0.0001,0.0000,0.0000,0.0141,0.0000,0.0001,0.0001,0.0000,0.0000,0.0058,0.0083,0.0001,0.0031,0.0000,0.0000,0.0013,0.0098,0.0069,0.0008,0.0040,0.0000,0.0019,0.0008,0.0000,0.0000,0.0000,0.0000,0.0000,0.0035,0.0000,0.0037,0.0000,-0.0001,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0107,0.0107,-0.0112,0.0112,-0.0010,0.0010,-0.0012,0.0012}
gradient norm = 0.03382658326054013
Starting Function Value: 3.676549485697434
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.675254379335506    0.079262551324533    2.343202998483004    0.011802367318186
         2            4    3.675015277228927    0.024190760933255    1.000000000000000    0.009030526482864
         3            5    3.674340652322634    0.122280447114569    1.000000000000000    0.007704057595854
         4            6    3.673937281499769    0.118452978274811    1.000000000000000    0.009753273236859
         5            7    3.673618597503239    0.202524338254828    1.000000000000000    0.007901762428919
         6            8    3.673527749446486    0.025161321555918    1.000000000000000    0.001811478495787
         7            9    3.673519846659879    0.011279205716781    1.000000000000000    0.001192666880196
         8           10    3.673511280681717    0.012672403779402    1.000000000000000    0.001189691524973
         9           11    3.673495240519102    0.024763078403902    1.000000000000000    0.001686672035279
        10           12    3.673472747192025    0.052267230293482    1.000000000000000    0.002049513245340
        11           14    3.673463507778556    0.028562294955590    0.477575774801446    0.001833771566683
        12           15    3.673456124392323    0.018085880311997    1.000000000000000    0.000756896215219
        13           16    3.673454035134138    0.007427189147076    1.000000000000000    0.000407538936055
        14           17    3.673453129955080    0.003830826096878    1.000000000000000    0.000460418774497
        15           18    3.673450075271571    0.017881914380784    1.000000000000000    0.000799740828221
        16           19    3.673448350824101    0.024119030517444    1.000000000000000    0.001351066427896
        17           20    3.673446141414225    0.003704644845818    1.000000000000000    0.000528478739511
        18           22    3.673445913203402    0.000570820963008    0.089033698786624    0.000488667717206
        19           23    3.673444656668883    0.009788195483095    1.000000000000000    0.000318762056421
        20           24    3.673444153310252    0.004121677373950    1.000000000000000    0.000371838259798
        21           25    3.673441969753766    0.025252957149016    1.000000000000000    0.000665680891778
        22           27    3.673441285754554    0.008619309680197    0.306973176179398    0.000554677087558
        23           28    3.673440620897887    0.005082342916883    1.000000000000000    0.000301367230897
        24           29    3.673440210644216    0.004401127122507    1.000000000000000    0.000181291413514
        25           30    3.673439968584400    0.002806171859246    1.000000000000000    0.000231918510280
        26           31    3.673438944755951    0.013793176613236    1.000000000000000    0.000433290407024
        27           32    3.673437689256993    0.020198714038141    1.000000000000000    0.000500622377864
        28           33    3.673435576088279    0.033367978324981    1.000000000000000    0.000396811832511
        29           34    3.673432680088935    0.055537123216963    1.000000000000000    0.000185277118055
        30           35    3.673430956484354    0.041275570763324    1.000000000000000    0.000265172149644
        31           36    3.673429742588757    0.030404995595038    1.000000000000000    0.000368020682540
        32           37    3.673428743485757    0.022152024779713    1.000000000000000    0.000316997778454
        33           38    3.673427673349068    0.020478856775710    1.000000000000000    0.000191940621652
        34           39    3.673426375518919    0.026673224750455    1.000000000000000    0.000320864784409
        35           40    3.673424994903856    0.032593709480754    1.000000000000000    0.000505230516053
        36           41    3.673423517089969    0.039339974860125    1.000000000000000    0.000487557232699
        37           42    3.673421351976470    0.055711745253480    1.000000000000000    0.000188153952535
        38           43    3.673420661191485    0.017501025785815    1.000000000000000    0.000106964180167
        39           44    3.673420442012672    0.006010655908959    1.000000000000000    0.000147570304796
        40           45    3.673420007652763    0.011844542831376    1.000000000000000    0.000157151123232
        41           46    3.673418765564497    0.040038762679475    1.000000000000000    0.000202294966685
        42           47    3.673417842030343    0.043937492332577    1.000000000000000    0.000154283647767
        43           48    3.673417538389945    0.018007294146592    1.000000000000000    0.000057044966408
        44           49    3.673417442746968    0.004713699248080    1.000000000000000    0.000076264201422
        45           50    3.673417312786754    0.005529942242874    1.000000000000000    0.000076614982870
        46           51    3.673416916647960    0.020435334326235    1.000000000000000    0.000056473806881
        47           52    3.673416583119749    0.025532954320824    1.000000000000000    0.000057764647841
        48           53    3.673416430395848    0.016110027704716    1.000000000000000    0.000043795193195
        49           54    3.673416344676715    0.009404354018975    1.000000000000000    0.000040259022290
        50           55    3.673416238595774    0.009647338870566    1.000000000000000    0.000041112033471
        51           56    3.673416077221472    0.018950385685195    1.000000000000000    0.000073429021889
        52           57    3.673416030782267    0.006562459893740    1.000000000000000    0.000016228984028
        53           58    3.673416011789809    0.001920009439101    1.000000000000000    0.000015139786026
        54           59    3.673415992367512    0.001918734115561    1.000000000000000    0.000015830712155
        55           62    3.673415898279707    0.011108912946585    0.660000000000000    0.000023578567704
        56           63    3.673415575404059    0.035642276052041    1.000000000000000    0.000048500543395
        57           64    3.673415547211173    0.037665082652747    1.000000000000000    0.000059127740921
        58           65    3.673415404660775    0.030310702009744    1.000000000000000    0.000041100256126
        59           66    3.673415250234740    0.029166640292811    1.000000000000000    0.000026506623148
        60           67    3.673415094891789    0.029346277956943    1.000000000000000    0.000033511827148
        61           68    3.673414820663036    0.054332191401473    1.000000000000000    0.000056871445204
        62           69    3.673414302429950    0.109203821891463    1.000000000000000    0.000078722883797
        63           70    3.673413496448102    0.209526447079102    1.000000000000000    0.000117773048162
        64           71    3.673412918869432    0.224753833428220    1.000000000000000    0.000077183943992
        65           72    3.673412327856800    0.040916499668446    1.000000000000000    0.000040818027723
        66           73    3.673411973423879    0.025966628190147    1.000000000000000    0.000050732613290
        67           74    3.673411631264545    0.044206118059365    1.000000000000000    0.000070133969550
        68           75    3.673410510457428    0.209363374190207    1.000000000000000    0.000109179781718
        69           76    3.673409069998739    0.347567604506800    1.000000000000000    0.000122741721868
        70           78    3.673408845003267    0.049801843543549    0.107421137126793    0.000112822383526
        71           79    3.673407021901080    0.639023663592976    1.000000000000000    0.000045450888061
        72           80    3.673406649048344    0.087590779244066    1.000000000000000    0.000048614596268
        73           81    3.673405910434875    0.174547191747765    1.000000000000000    0.000065086635418
        74           82    3.673405477457071    0.100045422010359    1.000000000000000    0.000069803641981
        75           83    3.673404939689759    0.080950350504666    1.000000000000000    0.000054616268508
        76           84    3.673404285617476    0.133182295419565    1.000000000000000    0.000098870160834
        77           85    3.673403938130402    0.096519165088218    1.000000000000000    0.000087664173496
        78           86    3.673403335058173    0.175019789521765    1.000000000000000    0.000048191037510
        79           87    3.673402925582526    0.130629120169042    1.000000000000000    0.000040477488484
        80           88    3.673402606818388    0.071106330339645    1.000000000000000    0.000075650100584
        81           89    3.673401973217180    0.126956680746528    1.000000000000000    0.000118941026183
        82           91    3.673401909832223    0.010254614864273    0.052655300047036    0.000119762915973
        83           92    3.673399584541214    0.543360652280746    1.000000000000000    0.000095861520305
        84           93    3.673398968435874    0.286778415047398    1.000000000000000    0.000119793261685
        85           94    3.673398519575671    0.039155289929267    1.000000000000000    0.000044493322921
        86           96    3.673398446010179    0.004587465448130    0.129102826532900    0.000041462941921
        87           97    3.673397441417727    0.059162374888344    1.000000000000000    0.000051034152441
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.1109e+00,-1.2857e+00,-1.1300e+00,-1.2406e+00,-7.4863e-01,-1.1247e+00,-1.6890e+00,2.1660e-01,-2.2608e+00,-1.1300e+00,-2.1107e+00,-6.6668e-01,-2.1727e+00,-2.1504e+00,-5.7006e-01,-2.2608e+00,2.4098e+00,-3.1087e+00,-3.4022e+00,-2.8087e+00,-2.1250e+00,-5.7006e-01,1.4561e+00,-4.0308e-01,-3.4391e+00,4.4758e-01,-3.0504e+00,-2.1250e+00,-1.1378e-01,4.2770e-01,6.3394e-03,-1.7857e+00,1.2869e-01,-3.0504e+00,-1.3494e+00,-1.8024e+00,8.0771e-02,9.6951e-02,8.0771e-02,9.9848e-02,8.0696e-02,-1.2003e+00,8.0696e-02,-9.4219e-01,8.0771e-02,-2.5444e+00,8.0771e-02,-2.9581e+00,5.4278e-01,-5.4278e-01,5.8620e-01,-5.8620e-01,1.0738e-01,-1.0738e-01,2.0303e-01,-2.0303e-01,3.8790e-01,-3.8790e-01,3.8702e-01,-3.8702e-01}
> Gradient:  {3.9308e-06,-3.3801e-06,-9.4478e-07,3.3922e-06,-7.5080e-06,2.7146e-06,-9.5670e-06,1.2433e-05,-3.1727e-06,-9.4478e-07,1.0266e-06,-1.5710e-06,6.3919e-06,9.4715e-07,-4.4770e-06,-3.1727e-06,-5.4979e-07,-1.7844e-06,-1.1165e-06,5.8881e-07,2.8799e-06,-4.4770e-06,-3.2980e-06,2.7780e-06,-4.2980e-06,2.2389e-06,-6.4127e-07,2.8799e-06,-5.2718e-08,-2.7715e-06,1.2886e-05,-6.7876e-06,-1.6818e-06,-6.4127e-07,-1.3961e-05,7.5410e-06,1.6154e-07,1.9390e-07,1.6154e-07,1.9970e-07,1.6139e-07,2.0712e-06,1.6139e-07,-3.9390e-06,1.6154e-07,1.8498e-06,1.6154e-07,-8.8852e-07,-5.7624e-06,5.7624e-06,-9.6159e-06,9.6159e-06,1.1426e-05,-1.1426e-05,-8.0598e-07,8.0598e-07,4.4820e-06,-4.4820e-06,2.2349e-05,-2.2349e-05}
>>>> Re-trying (1/3).
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.1109e+00,-1.2857e+00,-1.1300e+00,-1.2406e+00,-7.4863e-01,-1.1247e+00,-1.6890e+00,2.1660e-01,-2.2608e+00,-1.1300e+00,-2.1107e+00,-6.6668e-01,-2.1727e+00,-2.1504e+00,-5.7006e-01,-2.2608e+00,2.4098e+00,-3.1087e+00,-3.4022e+00,-2.8087e+00,-2.1250e+00,-5.7006e-01,1.4561e+00,-4.0308e-01,-3.4391e+00,4.4758e-01,-3.0504e+00,-2.1250e+00,-1.1378e-01,4.2770e-01,6.3394e-03,-1.7857e+00,1.2869e-01,-3.0504e+00,-1.3494e+00,-1.8024e+00,8.0771e-02,9.6951e-02,8.0771e-02,9.9848e-02,8.0696e-02,-1.2003e+00,8.0696e-02,-9.4219e-01,8.0771e-02,-2.5444e+00,8.0771e-02,-2.9581e+00,5.4278e-01,-5.4278e-01,5.8620e-01,-5.8620e-01,1.0738e-01,-1.0738e-01,2.0303e-01,-2.0303e-01,3.8790e-01,-3.8790e-01,3.8702e-01,-3.8702e-01}
> Gradient:  {3.9308e-06,-3.3801e-06,-9.4478e-07,3.3922e-06,-7.5080e-06,2.7146e-06,-9.5670e-06,1.2433e-05,-3.1727e-06,-9.4478e-07,1.0266e-06,-1.5710e-06,6.3919e-06,9.4715e-07,-4.4770e-06,-3.1727e-06,-5.4979e-07,-1.7844e-06,-1.1165e-06,5.8881e-07,2.8799e-06,-4.4770e-06,-3.2980e-06,2.7780e-06,-4.2980e-06,2.2389e-06,-6.4127e-07,2.8799e-06,-5.2718e-08,-2.7715e-06,1.2886e-05,-6.7876e-06,-1.6818e-06,-6.4127e-07,-1.3961e-05,7.5410e-06,1.6154e-07,1.9390e-07,1.6154e-07,1.9970e-07,1.6139e-07,2.0712e-06,1.6139e-07,-3.9390e-06,1.6154e-07,1.8498e-06,1.6154e-07,-8.8852e-07,-5.7624e-06,5.7624e-06,-9.5984e-06,9.5984e-06,1.1426e-05,-1.1426e-05,-8.0598e-07,8.0598e-07,4.4820e-06,-4.4820e-06,2.2349e-05,-2.2349e-05}
>>>> Re-trying (2/3).
Starting Function Value: 3.6733980306563376
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673398025416280    0.000202706535717    3.997286062788233    0.000040505748580
         2            4    3.673398021386835    0.000133138814637    1.000000000000000    0.000039170059904
         3            5    3.673397963619780    0.003334561349360    1.000000000000000    0.000051494314722
         4            7    3.673397958584957    0.000249505332913    0.079035661398834    0.000044513792050
         5            8    3.673397945508707    0.001563575870703    1.000000000000000    0.000041392922249
         6            9    3.673397941090874    0.000738968849923    1.000000000000000    0.000062442151978
         7           10    3.673397935743065    0.000148175569002    1.000000000000000    0.000042935013524
         8           11    3.673397917565332    0.001201692876845    1.000000000000000    0.000033624073784
         9           12    3.673397901795080    0.001202137873895    1.000000000000000    0.000032523258056
        10           14    3.673397896620316    0.000477218644045    0.272430830114311    0.000033091961162
Gradient   = {-6.0814e-07,-3.6305e-07,1.4287e-07,1.7021e-06,2.9557e-06,-1.8517e-06,3.7236e-06,-1.6616e-06,-3.1399e-06,1.4287e-07,2.5088e-07,2.6619e-06,4.3852e-06,-2.2315e-07,-4.0750e-06,-3.1399e-06,6.2700e-06,-2.0874e-06,-1.4086e-06,-6.1107e-07,2.7753e-06,-4.0750e-06,3.1453e-06,1.3039e-06,-4.2677e-06,6.8289e-07,-6.5314e-07,2.7753e-06,-1.1505e-06,3.7430e-06,4.9553e-06,-4.1175e-07,-8.3381e-06,-6.5314e-07,5.3751e-06,2.0240e-07,1.6142e-07,1.9375e-07,1.6142e-07,1.9954e-07,1.6127e-07,7.7562e-07,1.6127e-07,1.2968e-07,1.6142e-07,1.1054e-06,1.6142e-07,-1.0314e-06,-1.0905e-05,1.0905e-05,-5.8086e-06,5.8086e-06,-4.3279e-06,4.3279e-06,-1.2353e-05,1.2353e-05,-7.0516e-06,7.0516e-06,-9.9346e-07,9.9346e-07}
pCurr      = {2.0735e-05,6.2497e-04,-5.3647e-05,-8.5347e-04,3.0050e-04,6.7690e-04,4.7037e-04,2.2442e-04,1.0293e-03,-5.3647e-05,-2.3676e-04,-7.1765e-04,-1.7145e-03,-9.7136e-05,1.3970e-03,1.0293e-03,-2.3432e-04,6.1308e-04,4.4915e-04,5.4485e-05,-9.2146e-04,1.3970e-03,-3.0005e-04,3.1425e-04,1.4109e-03,2.7353e-04,2.1301e-04,-9.2146e-04,5.1845e-04,-5.0101e-04,-5.6714e-04,1.2261e-03,-1.3116e-04,2.1301e-04,1.0642e-03,-8.1166e-04,-5.2784e-05,-6.3357e-05,-5.2784e-05,-6.5250e-05,-5.2734e-05,6.3602e-04,-5.2734e-05,-9.8670e-05,-5.2784e-05,-4.2654e-04,-5.2784e-05,2.5019e-04,3.8103e-05,-3.8103e-05,1.7897e-05,-1.7897e-05,1.3210e-05,-1.3210e-05,3.2406e-05,-3.2406e-05,1.9051e-06,-1.9051e-06,4.7691e-06,-4.7691e-06}
grad*pCur  = -4.463872220813601E-8
parameters = {-2.1116e+00,-1.2847e+00,-1.1299e+00,-1.2419e+00,-7.4695e-01,-1.1247e+00,-1.6867e+00,2.1469e-01,-2.2596e+00,-1.1299e+00,-2.1111e+00,-6.6705e-01,-2.1750e+00,-2.1507e+00,-5.6836e-01,-2.2596e+00,2.4099e+00,-3.1081e+00,-3.4017e+00,-2.8089e+00,-2.1261e+00,-5.6836e-01,1.4564e+00,-4.0315e-01,-3.4374e+00,4.4750e-01,-3.0502e+00,-2.1261e+00,-1.1344e-01,4.2781e-01,4.3654e-03,-1.7835e+00,1.2762e-01,-3.0502e+00,-1.3457e+00,-1.8044e+00,8.0709e-02,9.6876e-02,8.0709e-02,9.9770e-02,8.0633e-02,-1.1998e+00,8.0633e-02,-9.4182e-01,8.0709e-02,-2.5451e+00,8.0709e-02,-2.9578e+00,5.4277e-01,-5.4277e-01,5.8621e-01,-5.8621e-01,1.0736e-01,-1.0736e-01,2.0306e-01,-2.0306e-01,3.8787e-01,-3.8787e-01,3.8696e-01,-3.8696e-01}
|grad|/|x| = 2.7486212980150634E-6
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.1116e+00,-1.2847e+00,-1.1299e+00,-1.2419e+00,-7.4695e-01,-1.1247e+00,-1.6867e+00,2.1469e-01,-2.2596e+00,-1.1299e+00,-2.1111e+00,-6.6705e-01,-2.1750e+00,-2.1507e+00,-5.6836e-01,-2.2596e+00,2.4099e+00,-3.1081e+00,-3.4017e+00,-2.8089e+00,-2.1261e+00,-5.6836e-01,1.4564e+00,-4.0315e-01,-3.4374e+00,4.4750e-01,-3.0502e+00,-2.1261e+00,-1.1344e-01,4.2781e-01,4.3654e-03,-1.7835e+00,1.2762e-01,-3.0502e+00,-1.3457e+00,-1.8044e+00,8.0709e-02,9.6876e-02,8.0709e-02,9.9770e-02,8.0633e-02,-1.1998e+00,8.0633e-02,-9.4182e-01,8.0709e-02,-2.5451e+00,8.0709e-02,-2.9578e+00,5.4277e-01,-5.4277e-01,5.8621e-01,-5.8621e-01,1.0736e-01,-1.0736e-01,2.0306e-01,-2.0306e-01,3.8787e-01,-3.8787e-01,3.8696e-01,-3.8696e-01}
> Gradient:  {-6.0814e-07,-3.6305e-07,1.4287e-07,1.7021e-06,2.9557e-06,-1.8517e-06,3.7236e-06,-1.6616e-06,-3.1399e-06,1.4287e-07,2.5088e-07,2.6619e-06,4.3852e-06,-2.2315e-07,-4.0750e-06,-3.1399e-06,6.2700e-06,-2.0874e-06,-1.4086e-06,-6.1107e-07,2.7753e-06,-4.0750e-06,3.1453e-06,1.3039e-06,-4.2677e-06,6.8289e-07,-6.5314e-07,2.7753e-06,-1.1505e-06,3.7430e-06,4.9553e-06,-4.1175e-07,-8.3381e-06,-6.5314e-07,5.3751e-06,2.0240e-07,1.6142e-07,1.9375e-07,1.6142e-07,1.9954e-07,1.6127e-07,7.7562e-07,1.6127e-07,1.2968e-07,1.6142e-07,1.1054e-06,1.6142e-07,-1.0314e-06,-1.0905e-05,1.0905e-05,-5.8086e-06,5.8086e-06,-4.3279e-06,4.3279e-06,-1.2353e-05,1.2353e-05,-7.0516e-06,7.0516e-06,-9.9346e-07,9.9346e-07}
>>>> Re-trying (3/3).
After: gradient norm = 3.309364427175176E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5862,-0.5862}

Count Table 2:
---------------
h:                 {0.1074,-0.1074}

Count Table 3:
---------------
h:                 {0.2031,-0.2031}

Count Table 4:
---------------
h:                 {0.3879,-0.3879}

Count Table 5:
---------------
h:                 {0.3870,-0.3870}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-1.2847,-2.1116,-1.1247,-0.7470,-1.1299,-1.2419,0.2147,-1.6867,-0.6671,-2.1111,-2.2596,-1.1299,-2.1507,-2.1750,-3.1081,2.4099,-0.5684,-2.2596,-2.8089,-3.4017,-0.4032,1.4564,-2.1261,-0.5684,0.4475,-3.4374,0.4278,-0.1134,-3.0502,-2.1261,-1.7835,0.0044,-1.8044,-1.3457,0.1276,-3.0502,-1.3457,-1.8044,0.0044,-1.7835,-3.0502,0.1276,-0.1134,0.4278,-3.4374,0.4475,-2.1261,-3.0502,1.4564,-0.4032,-3.4017,-2.8089,-0.5684,-2.1261,2.4099,-3.1081,-2.1750,-2.1507,-2.2596,-0.5684,-2.1111,-0.6671,-1.6867,0.2147,-1.1299,-2.2596,-0.7470,-1.1247,-2.1116,-1.2847,-1.2419,-1.1299}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0807,0.0969}
Activity(exp=1):   {0.0807,0.0998}
Activity(exp=2):   {0.0806,-1.1998}
Activity(exp=3):   {0.0806,-0.9418}
Activity(exp=4):   {0.0807,-2.5451}
Activity(exp=5):   {0.0807,-2.9578}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;6;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component2-2-variation3).
>>  Starting new optimization: component2-2-variation3. (2021-05-21 18:25:56.583).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.6733488074757448
gradient      = {-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0001,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0002,0.0002,-0.0002,0.0002,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 4.50043034102875E-4
Starting Function Value: 3.6733488074757448
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673348552606020    0.001106434711218    2.458508692225979    0.000177860928570
         2            4    3.673348492261068    0.000435373435093    1.000000000000000    0.000127926589252
         3            5    3.673348386636551    0.001372337934033    1.000000000000000    0.000096275918644
         4            6    3.673348292833670    0.001505830159231    1.000000000000000    0.000137983799912
         5            7    3.673348094301907    0.005048638025869    1.000000000000000    0.000218213421699
         6            8    3.673347120069368    0.007322735880012    1.000000000000000    0.000331827285811
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.1084e+00,-1.2847e+00,-1.1307e+00,-1.2424e+00,-7.4560e-01,-1.1236e+00,-1.6814e+00,2.1611e-01,-2.2590e+00,-1.1307e+00,-2.1107e+00,-6.6970e-01,-2.1680e+00,-2.1508e+00,-5.6764e-01,-2.2590e+00,2.4059e+00,-3.1077e+00,-3.4014e+00,-2.8089e+00,-2.1266e+00,-5.6764e-01,1.4627e+00,-4.0528e-01,-3.4365e+00,4.4646e-01,-3.0500e+00,-2.1266e+00,-1.1060e-01,4.3011e-01,2.5911e-03,-1.7834e+00,1.2656e-01,-3.0500e+00,-1.3455e+00,-1.7974e+00,8.0678e-02,9.6839e-02,8.0678e-02,9.9732e-02,8.0602e-02,-1.1981e+00,8.0602e-02,-9.4160e-01,8.0678e-02,-2.5453e+00,8.0678e-02,-2.9573e+00,5.4296e-01,-5.4296e-01,5.8629e-01,-5.8629e-01,1.0791e-01,-1.0791e-01,2.0413e-01,-2.0413e-01,3.8827e-01,-3.8827e-01,3.8710e-01,-3.8710e-01}
> Gradient:  {1.4327e-05,8.8658e-06,3.2108e-06,2.8975e-06,1.7161e-05,2.1944e-05,1.4585e-05,3.9770e-05,-3.0832e-06,3.2108e-06,1.4644e-06,1.2459e-05,-3.1250e-05,2.1445e-06,-3.5891e-06,-3.0832e-06,1.0446e-04,-1.1214e-06,-2.6682e-06,-2.0699e-06,2.5560e-06,-3.5891e-06,7.6978e-05,-3.6483e-06,-4.1686e-06,7.3479e-06,-6.3678e-07,2.5560e-06,2.2631e-06,6.0197e-05,4.6250e-05,6.6608e-06,9.8420e-06,-6.3678e-07,6.4259e-06,-9.8283e-07,1.6136e-07,1.9368e-07,1.6136e-07,1.9946e-07,1.6120e-07,2.2737e-05,1.6120e-07,1.2235e-05,1.6136e-07,9.2743e-07,1.6136e-07,-1.7102e-06,8.0367e-05,-8.0367e-05,3.0845e-05,-3.0845e-05,-1.1442e-04,1.1442e-04,1.0543e-04,-1.0543e-04,9.7283e-05,-9.7283e-05,9.7711e-06,-9.7711e-06}
>>>> Re-trying (1/3).
Starting Function Value: 3.6733479107261355
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673347758460241    0.000907712715424    2.737137552516730    0.000129471731605
         2            4    3.673347724880280    0.000341357879152    1.000000000000000    0.000088390276662
         3            5    3.673347677611634    0.000951897479381    1.000000000000000    0.000081984356955
         4            6    3.673347640601692    0.000988842863156    1.000000000000000    0.000116212828697
         5            7    3.673347571429859    0.001792781623705    1.000000000000000    0.000147493468667
         6            8    3.673347423910859    0.007073293250167    1.000000000000000    0.000257190247555
         7           10    3.673347318954981    0.002064555746684    0.375309271587491    0.000140149817653
         8           11    3.673347290500422    0.001214066414920    1.000000000000000    0.000076980318141
         9           12    3.673347255906215    0.001040387602563    1.000000000000000    0.000092378602990
        10           13    3.673347196195670    0.002109396932437    1.000000000000000    0.000146537683969
        11           14    3.673347051298890    0.005982414536037    1.000000000000000    0.000243972800073
        12           15    3.673346915328458    0.012613406098375    1.000000000000000    0.000350219480402
        13           16    3.673346554653773    0.017847838209239    1.000000000000000    0.000344428152630
        14           17    3.673346365835930    0.004740410613063    1.000000000000000    0.000162640715893
        15           18    3.673346298874930    0.001548664163351    1.000000000000000    0.000078096256586
        16           19    3.673346281065741    0.000421920015360    1.000000000000000    0.000079366172158
        17           20    3.673346241666020    0.001372853898395    1.000000000000000    0.000107616760858
        18           21    3.673346165420973    0.004258323518746    1.000000000000000    0.000109377104510
        19           22    3.673346095791294    0.004457285128687    1.000000000000000    0.000056736761407
        20           23    3.673346032713721    0.006225159437680    1.000000000000000    0.000070965166751
        21           24    3.673346002983323    0.003435019410621    1.000000000000000    0.000111351602576
        22           25    3.673345985022286    0.003357390667716    1.000000000000000    0.000097213860806
        23           27    3.673345961255586    0.000182555910315    0.062304630090812    0.000093333228200
        24           28    3.673345898683459    0.004578244573863    1.000000000000000    0.000051629863297
        25           29    3.673345884366220    0.001202308290327    1.000000000000000    0.000064814343864
        26           30    3.673345837222951    0.004865022761147    1.000000000000000    0.000073671491444
        27           31    3.673345788324812    0.004759659095654    1.000000000000000    0.000048555245064
        28           32    3.673345707024483    0.010316519307046    1.000000000000000    0.000041329159024
        29           33    3.673345619166434    0.004953739363870    1.000000000000000    0.000058178421401
        30           34    3.673345612389941    0.007757892051093    1.000000000000000    0.000049290671639
        31           35    3.673345555091897    0.009455754303908    1.000000000000000    0.000092770194105
        32           36    3.673345533438659    0.003068602200297    1.000000000000000    0.000023982608619
        33           37    3.673345528482278    0.000938434600905    1.000000000000000    0.000018156914622
        34           38    3.673345460196672    0.000724274388873    1.000000000000000    0.000020220165228
        35           40    3.673345350621919    0.000132387671438    0.060168452750721    0.000020520165929
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0935e+00,-1.2745e+00,-1.1256e+00,-1.2379e+00,-7.3995e-01,-1.1160e+00,-1.6718e+00,2.1332e-01,-2.2439e+00,-1.1256e+00,-2.0932e+00,-6.6635e-01,-2.1003e+00,-2.1595e+00,-5.6441e-01,-2.2439e+00,2.3795e+00,-3.1063e+00,-3.3766e+00,-2.7770e+00,-2.1367e+00,-5.6441e-01,1.4574e+00,-3.9768e-01,-3.4018e+00,4.5434e-01,-3.0455e+00,-2.1367e+00,-9.9106e-02,4.3391e-01,2.5136e-03,-1.7672e+00,1.2892e-01,-3.0455e+00,-1.3325e+00,-1.7811e+00,7.9820e-02,9.5809e-02,7.9820e-02,9.8672e-02,7.9745e-02,-1.1969e+00,7.9745e-02,-9.4202e-01,7.9820e-02,-2.5432e+00,7.9820e-02,-2.9362e+00,5.4280e-01,-5.4280e-01,5.8621e-01,-5.8621e-01,1.0860e-01,-1.0860e-01,2.0448e-01,-2.0448e-01,3.8813e-01,-3.8813e-01,3.8729e-01,-3.8729e-01}
> Gradient:  {4.1298e-06,1.6775e-07,4.9133e-07,1.0248e-06,-2.2788e-06,-4.7807e-06,2.9113e-06,2.9039e-06,-2.5172e-06,4.9133e-07,2.2714e-06,-7.3065e-06,2.8243e-06,-4.3251e-06,3.0923e-07,-2.5172e-06,3.8678e-06,-2.2342e-06,-2.1101e-06,2.0547e-06,1.1844e-06,3.0923e-07,-4.6558e-06,1.1423e-06,-2.9373e-06,2.2531e-06,-9.9703e-07,1.1844e-06,-5.5471e-07,-1.0236e-06,-2.8160e-06,-1.1187e-06,3.2104e-06,-9.9703e-07,-2.6584e-06,2.3045e-06,1.5964e-07,1.9162e-07,1.5964e-07,1.9734e-07,1.5949e-07,2.5007e-06,1.5949e-07,-1.1032e-06,1.5964e-07,-6.0744e-07,1.5964e-07,-1.4745e-06,6.2621e-06,-6.2621e-06,-4.3180e-06,4.3180e-06,-9.9238e-07,9.9238e-07,-3.7276e-06,3.7276e-06,-2.6604e-07,2.6604e-07,3.9823e-07,-3.9823e-07}
>>>> Re-trying (2/3).
Starting Function Value: 3.673345521134756
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673345519843951    0.000124626856472    6.072722725395646    0.000026732522181
         2            4    3.673345518264728    0.000101077935132    1.000000000000000    0.000025219014426
         3            5    3.673345510289849    0.002358526731263    1.000000000000000    0.000078348358753
         4            7    3.673345503937950    0.000265977085092    0.479863162792597    0.000024901787408
         5           11    3.673345502575676    0.000255626158197    0.504112275041316    0.000020358320101
         6           12    3.673345495478379    0.000332394209795    1.000000000000000    0.000022515781081
         7           13    3.673345494299776    0.000601915817242    1.000000000000000    0.000038512502999
Gradient   = {-7.7547e-07,3.8122e-07,3.3783e-07,7.8158e-07,2.1660e-06,5.2269e-06,-8.3535e-08,1.6067e-06,-2.4857e-06,3.3783e-07,1.6382e-06,7.1045e-06,3.1375e-06,-3.5385e-06,3.2455e-07,-2.4857e-06,1.1650e-05,-1.7988e-06,-2.0671e-06,1.6539e-06,1.1536e-06,3.2455e-07,6.8012e-06,-5.7672e-07,-2.5489e-06,2.0579e-06,-9.7080e-07,1.1536e-06,1.9884e-06,5.6091e-06,3.6321e-06,5.8714e-07,1.1624e-06,-9.7080e-07,1.2568e-06,1.6219e-06,1.5956e-07,1.9152e-07,1.5956e-07,1.9725e-07,1.5941e-07,3.6313e-06,1.5941e-07,1.8869e-06,1.5956e-07,-3.6814e-07,1.5956e-07,-1.1528e-06,4.5463e-06,-4.5463e-06,-1.0959e-05,1.0959e-05,6.4507e-06,-6.4507e-06,1.6933e-05,-1.6933e-05,1.1465e-06,-1.1465e-06,-8.4532e-06,8.4532e-06}
pCurr      = {6.5489e-05,5.7884e-05,-2.1167e-05,-6.6994e-05,1.1460e-04,9.6541e-06,7.4169e-05,9.8533e-05,2.3271e-04,-2.1167e-05,-1.7574e-04,-4.9035e-05,-2.8211e-04,3.6964e-04,-2.7771e-05,2.3271e-04,-2.4274e-04,1.8684e-04,1.9486e-04,-1.7348e-04,-1.0870e-04,-2.7771e-05,8.7547e-05,2.6413e-04,2.5624e-04,-7.0822e-05,9.1385e-05,-1.0870e-04,-1.6482e-05,8.4951e-05,1.1433e-04,2.6607e-05,1.0410e-04,9.1385e-05,9.1809e-05,-1.9166e-04,-1.4844e-05,-1.7818e-05,-1.4844e-05,-1.8350e-05,-1.4830e-05,-2.1971e-04,-1.4830e-05,1.3243e-04,-1.4844e-05,4.3135e-05,-1.4844e-05,1.2960e-04,4.4706e-07,-4.4706e-07,1.0555e-05,-1.0555e-05,-2.5582e-06,2.5582e-06,5.2818e-06,-5.2818e-06,9.5834e-07,-9.5834e-07,-1.4306e-06,1.4306e-06}
grad*pCur  = -8.275994895249845E-9
parameters = {-2.0939e+00,-1.2745e+00,-1.1257e+00,-1.2381e+00,-7.3951e-01,-1.1154e+00,-1.6721e+00,2.1310e-01,-2.2433e+00,-1.1257e+00,-2.0937e+00,-6.6554e-01,-2.1010e+00,-2.1585e+00,-5.6448e-01,-2.2433e+00,2.3787e+00,-3.1057e+00,-3.3761e+00,-2.7774e+00,-2.1369e+00,-5.6448e-01,1.4581e+00,-3.9744e-01,-3.4011e+00,4.5395e-01,-3.0453e+00,-2.1369e+00,-9.9058e-02,4.3416e-01,2.9931e-03,-1.7670e+00,1.2869e-01,-3.0453e+00,-1.3320e+00,-1.7817e+00,7.9780e-02,9.5761e-02,7.9780e-02,9.8623e-02,7.9706e-02,-1.1975e+00,7.9706e-02,-9.4167e-01,7.9780e-02,-2.5430e+00,7.9780e-02,-2.9358e+00,5.4280e-01,-5.4280e-01,5.8620e-01,-5.8620e-01,1.0862e-01,-1.0862e-01,2.0456e-01,-2.0456e-01,3.8814e-01,-3.8814e-01,3.8727e-01,-3.8727e-01}
|grad|/|x| = 3.2244402432708447E-6
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0939e+00,-1.2745e+00,-1.1257e+00,-1.2381e+00,-7.3951e-01,-1.1154e+00,-1.6721e+00,2.1310e-01,-2.2433e+00,-1.1257e+00,-2.0937e+00,-6.6553e-01,-2.1010e+00,-2.1585e+00,-5.6448e-01,-2.2433e+00,2.3787e+00,-3.1057e+00,-3.3761e+00,-2.7774e+00,-2.1369e+00,-5.6448e-01,1.4581e+00,-3.9745e-01,-3.4011e+00,4.5396e-01,-3.0453e+00,-2.1369e+00,-9.9058e-02,4.3416e-01,2.9907e-03,-1.7670e+00,1.2869e-01,-3.0453e+00,-1.3320e+00,-1.7817e+00,7.9780e-02,9.5762e-02,7.9780e-02,9.8623e-02,7.9706e-02,-1.1975e+00,7.9706e-02,-9.4168e-01,7.9780e-02,-2.5430e+00,7.9780e-02,-2.9358e+00,5.4280e-01,-5.4280e-01,5.8620e-01,-5.8620e-01,1.0862e-01,-1.0862e-01,2.0456e-01,-2.0456e-01,3.8814e-01,-3.8814e-01,3.8727e-01,-3.8727e-01}
> Gradient:  {-7.7547e-07,3.8122e-07,3.3783e-07,7.8158e-07,2.1660e-06,5.2269e-06,-8.3535e-08,1.6067e-06,-2.4857e-06,3.3783e-07,1.6382e-06,7.1045e-06,3.1375e-06,-3.5385e-06,3.2455e-07,-2.4857e-06,1.1650e-05,-1.7988e-06,-2.0671e-06,1.6539e-06,1.1536e-06,3.2455e-07,6.8012e-06,-5.7672e-07,-2.5489e-06,2.0579e-06,-9.7080e-07,1.1536e-06,1.9884e-06,5.6091e-06,3.6321e-06,5.8714e-07,1.1624e-06,-9.7080e-07,1.2568e-06,1.6219e-06,1.5956e-07,1.9152e-07,1.5956e-07,1.9725e-07,1.5941e-07,3.6313e-06,1.5941e-07,1.8869e-06,1.5956e-07,-3.6814e-07,1.5956e-07,-1.1528e-06,4.5463e-06,-4.5463e-06,-1.0959e-05,1.0959e-05,6.4507e-06,-6.4507e-06,1.6933e-05,-1.6933e-05,1.1465e-06,-1.1465e-06,-8.4532e-06,8.4532e-06}
>>>> Re-trying (3/3).
After: gradient norm = 3.858553718882495E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5862,-0.5862}

Count Table 2:
---------------
h:                 {0.1086,-0.1086}

Count Table 3:
---------------
h:                 {0.2046,-0.2046}

Count Table 4:
---------------
h:                 {0.3881,-0.3881}

Count Table 5:
---------------
h:                 {0.3873,-0.3873}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-1.2745,-2.0939,-1.1154,-0.7395,-1.1257,-1.2381,0.2131,-1.6721,-0.6655,-2.0937,-2.2433,-1.1257,-2.1585,-2.1010,-3.1057,2.3787,-0.5645,-2.2433,-2.7774,-3.3761,-0.3974,1.4581,-2.1369,-0.5645,0.4540,-3.4011,0.4342,-0.0991,-3.0453,-2.1369,-1.7670,0.0030,-1.7817,-1.3320,0.1287,-3.0453,-1.3320,-1.7817,0.0030,-1.7670,-3.0453,0.1287,-0.0991,0.4342,-3.4011,0.4540,-2.1369,-3.0453,1.4581,-0.3974,-3.3761,-2.7774,-0.5645,-2.1369,2.3787,-3.1057,-2.1010,-2.1585,-2.2433,-0.5645,-2.0937,-0.6655,-1.6721,0.2131,-1.1257,-2.2433,-0.7395,-1.1154,-2.0939,-1.2745,-1.2381,-1.1257}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0798,0.0958}
Activity(exp=1):   {0.0798,0.0986}
Activity(exp=2):   {0.0797,-1.1975}
Activity(exp=3):   {0.0797,-0.9417}
Activity(exp=4):   {0.0798,-2.5430}
Activity(exp=5):   {0.0798,-2.9358}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;7;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component2-2-variation4).
>>  Starting new optimization: component2-2-variation4. (2021-05-21 18:28:40.552).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.6733440619564623
gradient      = {-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 3.117539414082324E-5
Starting Function Value: 3.6733440619564623
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673344060286883    0.000106093812043    3.403126567183701    0.000018078786433
         2            4    3.673343847240586    0.000054643399119    1.000000000000000    0.000013194512583
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0939e+00,-1.2745e+00,-1.1257e+00,-1.2381e+00,-7.3951e-01,-1.1155e+00,-1.6721e+00,2.1310e-01,-2.2432e+00,-1.1257e+00,-2.0937e+00,-6.6558e-01,-2.1010e+00,-2.1585e+00,-5.6448e-01,-2.2432e+00,2.3786e+00,-3.1057e+00,-3.3761e+00,-2.7775e+00,-2.1370e+00,-5.6448e-01,1.4581e+00,-3.9744e-01,-3.4011e+00,4.5395e-01,-3.0453e+00,-2.1370e+00,-9.9057e-02,4.3412e-01,2.9789e-03,-1.7670e+00,1.2868e-01,-3.0453e+00,-1.3321e+00,-1.7817e+00,7.9779e-02,9.5760e-02,7.9779e-02,9.8622e-02,7.9705e-02,-1.1976e+00,7.9705e-02,-9.4168e-01,7.9779e-02,-2.5430e+00,7.9779e-02,-2.9358e+00,5.4279e-01,-5.4279e-01,5.8623e-01,-5.8623e-01,1.0861e-01,-1.0861e-01,2.0452e-01,-2.0452e-01,3.8814e-01,-3.8814e-01,3.8730e-01,-3.8730e-01}
> Gradient:  {-1.8152e-06,-9.5974e-07,2.2928e-07,6.8699e-07,-1.2861e-06,1.8322e-06,-2.6089e-06,-1.6401e-06,-2.4818e-06,2.2928e-07,1.1432e-06,4.0458e-06,1.7224e-06,-3.4667e-06,3.5671e-07,-2.4818e-06,3.4940e-06,-1.7656e-06,-3.4799e-06,1.6719e-06,1.1605e-06,3.5671e-07,4.0787e-07,-2.2582e-06,-2.5746e-06,-7.7636e-07,-9.7098e-07,1.1605e-06,-1.0359e-06,2.0563e-06,-1.0801e-06,1.5306e-07,-4.1974e-07,-9.7098e-07,5.2803e-07,-3.5132e-07,1.5956e-07,1.9152e-07,1.5956e-07,1.9724e-07,1.5941e-07,1.5921e-06,1.5941e-07,-2.7203e-07,1.5956e-07,-5.3432e-07,1.5956e-07,-1.5038e-06,-1.3592e-06,1.3592e-06,3.0676e-06,-3.0676e-06,1.3516e-06,-1.3516e-06,-1.0084e-06,1.0084e-06,2.5166e-07,-2.5166e-07,3.3217e-06,-3.3217e-06}
>>>> Re-trying (1/3).
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0939e+00,-1.2745e+00,-1.1257e+00,-1.2381e+00,-7.3951e-01,-1.1155e+00,-1.6721e+00,2.1310e-01,-2.2432e+00,-1.1257e+00,-2.0937e+00,-6.6558e-01,-2.1010e+00,-2.1585e+00,-5.6448e-01,-2.2432e+00,2.3786e+00,-3.1057e+00,-3.3761e+00,-2.7775e+00,-2.1370e+00,-5.6448e-01,1.4581e+00,-3.9744e-01,-3.4011e+00,4.5395e-01,-3.0453e+00,-2.1370e+00,-9.9057e-02,4.3412e-01,2.9789e-03,-1.7670e+00,1.2868e-01,-3.0453e+00,-1.3321e+00,-1.7817e+00,7.9779e-02,9.5760e-02,7.9779e-02,9.8622e-02,7.9705e-02,-1.1976e+00,7.9705e-02,-9.4168e-01,7.9779e-02,-2.5430e+00,7.9779e-02,-2.9358e+00,5.4279e-01,-5.4279e-01,5.8623e-01,-5.8623e-01,1.0861e-01,-1.0861e-01,2.0452e-01,-2.0452e-01,3.8814e-01,-3.8814e-01,3.8730e-01,-3.8730e-01}
> Gradient:  {-1.8152e-06,-9.5974e-07,2.2928e-07,6.8699e-07,-1.2861e-06,1.8322e-06,-2.6089e-06,-1.6401e-06,-2.4818e-06,2.2928e-07,1.1432e-06,4.0458e-06,1.7224e-06,-3.4667e-06,3.5671e-07,-2.4818e-06,3.4940e-06,-1.7656e-06,-3.4799e-06,1.6719e-06,1.1605e-06,3.5671e-07,4.0787e-07,-2.2582e-06,-2.5746e-06,-7.7636e-07,-9.7098e-07,1.1605e-06,-1.0359e-06,2.0563e-06,-1.0801e-06,1.5306e-07,-4.1974e-07,-9.7098e-07,5.2803e-07,-3.5132e-07,1.5956e-07,1.9152e-07,1.5956e-07,1.9724e-07,1.5941e-07,1.5921e-06,1.5941e-07,-2.7203e-07,1.5956e-07,-5.3432e-07,1.5956e-07,-1.5038e-06,-1.3592e-06,1.3592e-06,3.0676e-06,-3.0676e-06,1.3516e-06,-1.3516e-06,-1.0084e-06,1.0084e-06,2.5166e-07,-2.5166e-07,3.3217e-06,-3.3217e-06}
>>>> Re-trying (2/3).
Starting Function Value: 3.6733440594901703
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673344058911777    0.000100567697133    7.608931556443455    0.000019318116127
         2            4    3.673344058028440    0.000084512796033    1.000000000000000    0.000018303414291
         3            5    3.673344047754327    0.002052075555566    1.000000000000000    0.000032142354492
         4            7    3.673344045072101    0.000518514879363    0.336855290438400    0.000024206710597
         5            8    3.673344043697238    0.000118777595203    1.000000000000000    0.000018824076990
         6            9    3.673344039618886    0.000668372969379    1.000000000000000    0.000026992930160
         7           10    3.673344034678201    0.000979845728670    1.000000000000000    0.000042036819188
         8           11    3.673344020286866    0.003244157221617    1.000000000000000    0.000065204968437
         9           12    3.673344007684894    0.004792128132133    1.000000000000000    0.000099865512507
        10           15    3.673344003516753    0.000596691603601    0.177964938136397    0.000086756011429
        11           16    3.673343988553167    0.002746598219393    1.000000000000000    0.000022062268316
Gradient   = {-3.5804e-06,3.5687e-07,-1.0619e-06,-1.3426e-06,3.1439e-06,2.3567e-06,4.7205e-06,-7.6892e-07,-2.2937e-06,-1.0619e-06,-2.4365e-06,1.7129e-06,1.7743e-06,-1.7100e-07,3.0237e-07,-2.2937e-06,-2.1408e-07,-3.4809e-07,-2.8080e-06,-1.8488e-06,9.4959e-07,3.0237e-07,8.2446e-06,-5.7899e-06,-1.3626e-06,4.7273e-06,-9.1855e-07,9.4959e-07,4.7981e-06,-9.1441e-06,5.9776e-06,-1.2501e-06,-3.4116e-06,-9.1855e-07,-2.8877e-06,1.5402e-06,1.5899e-07,1.9083e-07,1.5899e-07,1.9654e-07,1.5884e-07,-1.2620e-06,1.5884e-07,2.2371e-06,1.5899e-07,-2.1807e-07,1.5899e-07,-8.8630e-07,2.9275e-06,-2.9275e-06,-3.2693e-06,3.2693e-06,4.5134e-06,-4.5134e-06,-6.8642e-07,6.8642e-07,1.7849e-06,-1.7849e-06,1.9370e-06,-1.9370e-06}
pCurr      = {2.3386e-05,1.6890e-05,2.5143e-06,-1.0456e-05,-5.6959e-06,1.1728e-05,-1.0648e-05,-2.8787e-05,8.8210e-05,2.5143e-06,-7.1032e-06,-5.8196e-06,-6.0711e-05,1.0003e-04,-1.3020e-05,8.8210e-05,-1.0016e-04,5.3868e-05,1.2030e-04,-3.2226e-05,-4.0342e-05,-1.3020e-05,-1.6800e-05,5.0303e-05,8.4058e-05,-3.1051e-05,3.4738e-05,-4.0342e-05,-1.3769e-05,3.4584e-05,-2.1731e-05,1.6415e-05,8.3846e-06,3.4738e-05,2.1518e-05,8.8942e-06,-5.7531e-06,-6.9056e-06,-5.7531e-06,-7.1119e-06,-5.7478e-06,-3.3089e-05,-5.7478e-06,-1.4048e-05,-5.7531e-06,1.8400e-05,-5.7531e-06,5.0178e-05,-2.8258e-06,2.8258e-06,1.2238e-05,-1.2238e-05,-7.7089e-06,7.7089e-06,-3.9202e-06,3.9202e-06,-4.4789e-06,4.4789e-06,-1.0428e-05,1.0428e-05}
grad*pCur  = -2.597738123975208E-9
parameters = {-2.0929e+00,-1.2730e+00,-1.1259e+00,-1.2391e+00,-7.3810e-01,-1.1142e+00,-1.6701e+00,2.1269e-01,-2.2388e+00,-1.1259e+00,-2.0950e+00,-6.6612e-01,-2.1040e+00,-2.1526e+00,-5.6514e-01,-2.2388e+00,2.3743e+00,-3.1026e+00,-3.3699e+00,-2.7800e+00,-2.1390e+00,-5.6514e-01,1.4606e+00,-3.9540e-01,-3.3966e+00,4.5463e-01,-3.0435e+00,-2.1390e+00,-9.7760e-02,4.3336e-01,4.7062e-03,-1.7664e+00,1.2862e-01,-3.0435e+00,-1.3317e+00,-1.7805e+00,7.9493e-02,9.5417e-02,7.9493e-02,9.8268e-02,7.9419e-02,-1.1996e+00,7.9419e-02,-9.4123e-01,7.9493e-02,-2.5420e+00,7.9493e-02,-2.9331e+00,5.4280e-01,-5.4280e-01,5.8622e-01,-5.8622e-01,1.0863e-01,-1.0863e-01,2.0460e-01,-2.0460e-01,3.8816e-01,-3.8816e-01,3.8733e-01,-3.8733e-01}
|grad|/|x| = 1.8448300774464436E-6
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0929e+00,-1.2730e+00,-1.1259e+00,-1.2391e+00,-7.3810e-01,-1.1142e+00,-1.6701e+00,2.1269e-01,-2.2388e+00,-1.1259e+00,-2.0950e+00,-6.6612e-01,-2.1040e+00,-2.1526e+00,-5.6514e-01,-2.2388e+00,2.3743e+00,-3.1026e+00,-3.3699e+00,-2.7800e+00,-2.1390e+00,-5.6514e-01,1.4606e+00,-3.9540e-01,-3.3966e+00,4.5463e-01,-3.0435e+00,-2.1390e+00,-9.7760e-02,4.3336e-01,4.7062e-03,-1.7664e+00,1.2862e-01,-3.0435e+00,-1.3317e+00,-1.7805e+00,7.9493e-02,9.5417e-02,7.9493e-02,9.8268e-02,7.9419e-02,-1.1996e+00,7.9419e-02,-9.4123e-01,7.9493e-02,-2.5420e+00,7.9493e-02,-2.9331e+00,5.4280e-01,-5.4280e-01,5.8622e-01,-5.8622e-01,1.0863e-01,-1.0863e-01,2.0460e-01,-2.0460e-01,3.8816e-01,-3.8816e-01,3.8733e-01,-3.8733e-01}
> Gradient:  {-3.5804e-06,3.5687e-07,-1.0619e-06,-1.3426e-06,3.1439e-06,2.3567e-06,4.7205e-06,-7.6892e-07,-2.2937e-06,-1.0619e-06,-2.4365e-06,1.7129e-06,1.7743e-06,-1.7100e-07,3.0237e-07,-2.2937e-06,-2.1408e-07,-3.4809e-07,-2.8080e-06,-1.8488e-06,9.4959e-07,3.0237e-07,8.2446e-06,-5.7899e-06,-1.3626e-06,4.7273e-06,-9.1855e-07,9.4959e-07,4.7981e-06,-9.1441e-06,5.9776e-06,-1.2501e-06,-3.4116e-06,-9.1855e-07,-2.8877e-06,1.5402e-06,1.5899e-07,1.9083e-07,1.5899e-07,1.9654e-07,1.5884e-07,-1.2620e-06,1.5884e-07,2.2371e-06,1.5899e-07,-2.1807e-07,1.5899e-07,-8.8630e-07,2.9275e-06,-2.9275e-06,-3.2693e-06,3.2693e-06,4.5134e-06,-4.5134e-06,-6.8642e-07,6.8642e-07,1.7849e-06,-1.7849e-06,1.9370e-06,-1.9370e-06}
>>>> Re-trying (3/3).
After: gradient norm = 2.2062268315702704E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5862,-0.5862}

Count Table 2:
---------------
h:                 {0.1086,-0.1086}

Count Table 3:
---------------
h:                 {0.2046,-0.2046}

Count Table 4:
---------------
h:                 {0.3882,-0.3882}

Count Table 5:
---------------
h:                 {0.3873,-0.3873}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-1.2730,-2.0929,-1.1142,-0.7381,-1.1259,-1.2391,0.2127,-1.6701,-0.6661,-2.0950,-2.2388,-1.1259,-2.1526,-2.1040,-3.1026,2.3743,-0.5651,-2.2388,-2.7800,-3.3699,-0.3954,1.4606,-2.1390,-0.5651,0.4546,-3.3966,0.4334,-0.0978,-3.0435,-2.1390,-1.7664,0.0047,-1.7805,-1.3317,0.1286,-3.0435,-1.3317,-1.7805,0.0047,-1.7664,-3.0435,0.1286,-0.0978,0.4334,-3.3966,0.4546,-2.1390,-3.0435,1.4606,-0.3954,-3.3699,-2.7800,-0.5651,-2.1390,2.3743,-3.1026,-2.1040,-2.1526,-2.2388,-0.5651,-2.0950,-0.6661,-1.6701,0.2127,-1.1259,-2.2388,-0.7381,-1.1142,-2.0929,-1.2730,-1.2391,-1.1259}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0795,0.0954}
Activity(exp=1):   {0.0795,0.0983}
Activity(exp=2):   {0.0794,-1.1996}
Activity(exp=3):   {0.0794,-0.9412}
Activity(exp=4):   {0.0795,-2.5420}
Activity(exp=5):   {0.0795,-2.9331}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;8;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component2-2-variation5).
>>  Starting new optimization: component2-2-variation5. (2021-05-21 18:30:04.147).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.673343986636629
gradient      = {-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000}
gradient norm = 2.2060084022325913E-5
Starting Function Value: 3.673343986636629
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673343984077602    0.000230719961669   10.458707293932259    0.000039592674066
         2            4    3.673343980465591    0.000204073292458    1.000000000000000    0.000034133960628
         3            5    3.673343968931976    0.001777343975785    1.000000000000000    0.000049381062335
         4            7    3.673343966120285    0.000223888567868    0.358568837373492    0.000016221425932
         5            8    3.673343965344712    0.000228565300545    1.000000000000000    0.000012821221123
         6            9    3.673343963713388    0.000178007917234    1.000000000000000    0.000014268583168
         7           10    3.673343958942023    0.001013412427536    1.000000000000000    0.000036048885013
         8           11    3.673343955201764    0.000721111846384    1.000000000000000    0.000022348440881
         9           12    3.673343953221697    0.000620779449554    1.000000000000000    0.000014027647208
        10           13    3.673343952389772    0.000422265101081    1.000000000000000    0.000012774006080
Gradient   = {-1.2412e-06,4.9910e-08,-2.5869e-07,-9.1857e-07,-1.2278e-06,3.1551e-06,-3.0027e-06,1.7917e-06,-2.2711e-06,-2.5869e-07,-7.7320e-07,4.0726e-06,8.9174e-07,-5.1156e-07,1.6377e-07,-2.2711e-06,1.0941e-06,-6.2951e-07,-2.5210e-06,-1.3561e-06,9.1954e-07,1.6377e-07,-3.9121e-07,1.9224e-06,-1.5917e-06,-1.9428e-09,-9.2888e-07,9.1954e-07,-2.3548e-06,2.6953e-06,3.7925e-07,1.0260e-07,-2.6276e-06,-9.2888e-07,1.7328e-06,7.9246e-08,1.5885e-07,1.9067e-07,1.5885e-07,1.9637e-07,1.5870e-07,7.5492e-07,1.5870e-07,1.7148e-07,1.5885e-07,-4.2469e-07,1.5885e-07,-7.8851e-07,9.2853e-07,-9.2853e-07,4.1883e-06,-4.1883e-06,3.1826e-06,-3.1826e-06,-1.6188e-06,1.6188e-06,-3.7600e-07,3.7600e-07,9.0335e-07,-9.0335e-07}
pCurr      = {3.6529e-05,4.5774e-06,2.3071e-05,3.9407e-05,-4.1256e-06,-2.5548e-05,-6.1313e-05,-9.7346e-06,7.9203e-05,2.3071e-05,6.4860e-05,-2.2175e-05,-4.3180e-05,1.2703e-05,-8.1394e-06,7.9203e-05,4.4043e-05,1.7792e-05,9.3826e-05,5.6595e-05,-3.2399e-05,-8.1394e-06,-1.0918e-05,3.4558e-06,5.3792e-05,1.8261e-05,3.2188e-05,-3.2399e-05,-1.7640e-06,3.2342e-05,-4.5432e-05,3.7812e-05,4.1400e-05,3.2188e-05,3.3975e-05,2.4768e-06,-5.5125e-06,-6.6168e-06,-5.5125e-06,-6.8145e-06,-5.5074e-06,3.2152e-05,-5.5074e-06,-3.9669e-05,-5.5125e-06,1.4886e-05,-5.5125e-06,3.1869e-05,-1.3159e-06,1.3159e-06,-1.0295e-05,1.0295e-05,-5.5245e-06,5.5245e-06,1.9329e-06,-1.9329e-06,4.8239e-06,-4.8239e-06,-1.8170e-06,1.8170e-06}
grad*pCur  = -1.1510116367172184E-9
parameters = {-2.0925e+00,-1.2730e+00,-1.1256e+00,-1.2386e+00,-7.3867e-01,-1.1142e+00,-1.6720e+00,2.1276e-01,-2.2378e+00,-1.1256e+00,-2.0940e+00,-6.6589e-01,-2.1046e+00,-2.1525e+00,-5.6526e-01,-2.2378e+00,2.3748e+00,-3.1025e+00,-3.3687e+00,-2.7793e+00,-2.1394e+00,-5.6526e-01,1.4596e+00,-3.9480e-01,-3.3960e+00,4.5456e-01,-3.0431e+00,-2.1394e+00,-9.8567e-02,4.3468e-01,3.6045e-03,-1.7658e+00,1.2879e-01,-3.0431e+00,-1.3307e+00,-1.7806e+00,7.9426e-02,9.5336e-02,7.9426e-02,9.8185e-02,7.9352e-02,-1.1989e+00,7.9352e-02,-9.4210e-01,7.9426e-02,-2.5418e+00,7.9426e-02,-2.9327e+00,5.4279e-01,-5.4279e-01,5.8623e-01,-5.8623e-01,1.0864e-01,-1.0864e-01,2.0458e-01,-2.0458e-01,3.8816e-01,-3.8816e-01,3.8733e-01,-3.8733e-01}
|grad|/|x| = 1.068139566616958E-6
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0925e+00,-1.2730e+00,-1.1256e+00,-1.2386e+00,-7.3867e-01,-1.1142e+00,-1.6720e+00,2.1276e-01,-2.2378e+00,-1.1256e+00,-2.0940e+00,-6.6589e-01,-2.1046e+00,-2.1525e+00,-5.6526e-01,-2.2378e+00,2.3748e+00,-3.1025e+00,-3.3687e+00,-2.7793e+00,-2.1394e+00,-5.6526e-01,1.4596e+00,-3.9480e-01,-3.3960e+00,4.5456e-01,-3.0431e+00,-2.1394e+00,-9.8567e-02,4.3468e-01,3.6045e-03,-1.7658e+00,1.2879e-01,-3.0431e+00,-1.3307e+00,-1.7806e+00,7.9426e-02,9.5336e-02,7.9426e-02,9.8185e-02,7.9352e-02,-1.1989e+00,7.9352e-02,-9.4210e-01,7.9426e-02,-2.5418e+00,7.9426e-02,-2.9327e+00,5.4279e-01,-5.4279e-01,5.8623e-01,-5.8623e-01,1.0864e-01,-1.0864e-01,2.0458e-01,-2.0458e-01,3.8816e-01,-3.8816e-01,3.8733e-01,-3.8733e-01}
> Gradient:  {-1.2412e-06,4.9910e-08,-2.5869e-07,-9.1857e-07,-1.2278e-06,3.1551e-06,-3.0027e-06,1.7917e-06,-2.2711e-06,-2.5869e-07,-7.7320e-07,4.0726e-06,8.9174e-07,-5.1156e-07,1.6377e-07,-2.2711e-06,1.0941e-06,-6.2951e-07,-2.5210e-06,-1.3561e-06,9.1954e-07,1.6377e-07,-3.9121e-07,1.9224e-06,-1.5917e-06,-1.9428e-09,-9.2888e-07,9.1954e-07,-2.3548e-06,2.6953e-06,3.7925e-07,1.0260e-07,-2.6276e-06,-9.2888e-07,1.7328e-06,7.9246e-08,1.5885e-07,1.9067e-07,1.5885e-07,1.9637e-07,1.5870e-07,7.5492e-07,1.5870e-07,1.7148e-07,1.5885e-07,-4.2469e-07,1.5885e-07,-7.8851e-07,9.2853e-07,-9.2853e-07,4.1883e-06,-4.1883e-06,3.1826e-06,-3.1826e-06,-1.6188e-06,1.6188e-06,-3.7600e-07,3.7600e-07,9.0335e-07,-9.0335e-07}
>>>> Re-trying (1/3).
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0925e+00,-1.2730e+00,-1.1256e+00,-1.2386e+00,-7.3867e-01,-1.1142e+00,-1.6720e+00,2.1276e-01,-2.2378e+00,-1.1256e+00,-2.0940e+00,-6.6589e-01,-2.1046e+00,-2.1525e+00,-5.6526e-01,-2.2378e+00,2.3748e+00,-3.1025e+00,-3.3687e+00,-2.7793e+00,-2.1394e+00,-5.6526e-01,1.4596e+00,-3.9480e-01,-3.3960e+00,4.5456e-01,-3.0431e+00,-2.1394e+00,-9.8567e-02,4.3468e-01,3.6045e-03,-1.7658e+00,1.2879e-01,-3.0431e+00,-1.3307e+00,-1.7806e+00,7.9426e-02,9.5336e-02,7.9426e-02,9.8185e-02,7.9352e-02,-1.1989e+00,7.9352e-02,-9.4210e-01,7.9426e-02,-2.5418e+00,7.9426e-02,-2.9327e+00,5.4279e-01,-5.4279e-01,5.8623e-01,-5.8623e-01,1.0864e-01,-1.0864e-01,2.0458e-01,-2.0458e-01,3.8816e-01,-3.8816e-01,3.8733e-01,-3.8733e-01}
> Gradient:  {-1.2413e-06,4.9899e-08,-2.5869e-07,-9.1857e-07,-1.2278e-06,3.1551e-06,-3.0027e-06,1.7917e-06,-2.2711e-06,-2.5869e-07,-7.7321e-07,4.0725e-06,8.9174e-07,-5.1156e-07,1.6377e-07,-2.2711e-06,1.0940e-06,-6.2951e-07,-2.5210e-06,-1.3561e-06,9.1954e-07,1.6377e-07,-3.9125e-07,1.9224e-06,-1.5917e-06,-1.9641e-09,-9.2888e-07,9.1954e-07,-2.3548e-06,2.6953e-06,3.7923e-07,1.0260e-07,-2.6276e-06,-9.2888e-07,1.7328e-06,7.9240e-08,1.5885e-07,1.9067e-07,1.5885e-07,1.9637e-07,1.5870e-07,7.5491e-07,1.5870e-07,1.7146e-07,1.5885e-07,-4.2469e-07,1.5885e-07,-7.8851e-07,9.2854e-07,-9.2854e-07,4.1908e-06,-4.1908e-06,3.1827e-06,-3.1827e-06,-1.6188e-06,1.6188e-06,-3.7604e-07,3.7604e-07,9.0338e-07,-9.0338e-07}
>>>> Re-trying (2/3).
Starting Function Value: 3.67334395819661
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673343951959647    0.000066522837069    5.207897717918600    0.000014585100406
         2            4    3.673343951485013    0.000051571558125    1.000000000000000    0.000013819179503
         3            5    3.673343946609267    0.001252136211504    1.000000000000000    0.000029585628820
         4            7    3.673343945499458    0.000212372315138    0.267292046557517    0.000010327609185
         5            8    3.673343945191365    0.000103989870482    1.000000000000000    0.000008999237002
         6            9    3.673343944189529    0.000171339616352    1.000000000000000    0.000010985836154
         7           10    3.673343942482925    0.000784249011807    1.000000000000000    0.000035165692624
         8           11    3.673343939996429    0.000450470248449    1.000000000000000    0.000015973057553
         9           12    3.673343938198009    0.000766967392696    1.000000000000000    0.000013522356753
        10           13    3.673343936840709    0.000682845799924    1.000000000000000    0.000014953177894
        11           14    3.673343936200560    0.002590866766290    1.000000000000000    0.000072845191029
        12           15    3.673343910482161    0.000480781648231    1.000000000000000    0.000029877677823
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0921e+00,-1.2729e+00,-1.1255e+00,-1.2377e+00,-7.3807e-01,-1.1143e+00,-1.6710e+00,2.1163e-01,-2.2352e+00,-1.1255e+00,-2.0934e+00,-6.6713e-01,-2.1055e+00,-2.1519e+00,-5.6542e-01,-2.2352e+00,2.3748e+00,-3.1018e+00,-3.3658e+00,-2.7777e+00,-2.1405e+00,-5.6542e-01,1.4599e+00,-3.9546e-01,-3.3942e+00,4.5477e-01,-3.0420e+00,-2.1405e+00,-9.7114e-02,4.3405e-01,4.4413e-03,-1.7653e+00,1.2894e-01,-3.0420e+00,-1.3309e+00,-1.7801e+00,7.9239e-02,9.5112e-02,7.9239e-02,9.7954e-02,7.9165e-02,-1.1990e+00,7.9165e-02,-9.4233e-01,7.9239e-02,-2.5413e+00,7.9239e-02,-2.9319e+00,5.4278e-01,-5.4278e-01,5.8623e-01,-5.8623e-01,1.0862e-01,-1.0862e-01,2.0458e-01,-2.0458e-01,3.8815e-01,-3.8815e-01,3.8737e-01,-3.8737e-01}
> Gradient:  {-9.6524e-08,-1.4883e-06,1.1644e-07,-4.6850e-07,1.1599e-06,-2.4919e-06,4.5450e-06,-3.7135e-06,-2.1877e-06,1.1644e-07,1.0479e-06,-3.0770e-06,7.4916e-09,-7.4802e-07,-9.3152e-08,-2.1877e-06,-4.4021e-07,-6.2467e-07,-1.9502e-06,-1.0236e-06,8.1690e-07,-9.3152e-08,2.0790e-06,-3.9153e-06,-1.1660e-06,-4.3485e-07,-9.0793e-07,8.1690e-07,4.0153e-06,-6.4096e-06,5.0140e-06,-5.5303e-07,-4.8042e-06,-9.0793e-07,-2.7919e-06,-4.3164e-08,1.5848e-07,1.9022e-07,1.5848e-07,1.9591e-07,1.5833e-07,2.2210e-06,1.5833e-07,-3.0774e-06,1.5848e-07,-1.4557e-07,1.5848e-07,-7.0039e-07,-2.9079e-06,2.9079e-06,9.5972e-07,-9.5972e-07,-1.1749e-05,1.1749e-05,-3.6039e-06,3.6039e-06,-7.2838e-06,7.2838e-06,1.0992e-05,-1.0992e-05}
>>>> Re-trying (3/3).
After: gradient norm = 2.9867280380561986E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5862,-0.5862}

Count Table 2:
---------------
h:                 {0.1086,-0.1086}

Count Table 3:
---------------
h:                 {0.2046,-0.2046}

Count Table 4:
---------------
h:                 {0.3881,-0.3881}

Count Table 5:
---------------
h:                 {0.3874,-0.3874}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-1.2729,-2.0921,-1.1143,-0.7381,-1.1255,-1.2377,0.2116,-1.6710,-0.6671,-2.0934,-2.2352,-1.1255,-2.1519,-2.1055,-3.1018,2.3748,-0.5654,-2.2352,-2.7777,-3.3658,-0.3955,1.4599,-2.1405,-0.5654,0.4548,-3.3942,0.4340,-0.0971,-3.0420,-2.1405,-1.7653,0.0044,-1.7801,-1.3309,0.1289,-3.0420,-1.3309,-1.7801,0.0044,-1.7653,-3.0420,0.1289,-0.0971,0.4340,-3.3942,0.4548,-2.1405,-3.0420,1.4599,-0.3955,-3.3658,-2.7777,-0.5654,-2.1405,2.3748,-3.1018,-2.1055,-2.1519,-2.2352,-0.5654,-2.0934,-0.6671,-1.6710,0.2116,-1.1255,-2.2352,-0.7381,-1.1143,-2.0921,-1.2729,-1.2377,-1.1255}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0792,0.0951}
Activity(exp=1):   {0.0792,0.0980}
Activity(exp=2):   {0.0792,-1.1990}
Activity(exp=3):   {0.0792,-0.9423}
Activity(exp=4):   {0.0792,-2.5413}
Activity(exp=5):   {0.0792,-2.9319}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;9;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component2-2-variation6).
>>  Starting new optimization: component2-2-variation6. (2021-05-21 18:32:15.296).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.6733439289128174
gradient      = {-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000}
gradient norm = 2.987347292629233E-5
Starting Function Value: 3.6733439289128174
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673343883713894    0.000094247688633    3.154895611417800    0.000017333302700
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0921e+00,-1.2729e+00,-1.1255e+00,-1.2377e+00,-7.3807e-01,-1.1143e+00,-1.6711e+00,2.1164e-01,-2.2352e+00,-1.1255e+00,-2.0934e+00,-6.6712e-01,-2.1055e+00,-2.1518e+00,-5.6542e-01,-2.2352e+00,2.3748e+00,-3.1017e+00,-3.3658e+00,-2.7777e+00,-2.1405e+00,-5.6542e-01,1.4599e+00,-3.9545e-01,-3.3942e+00,4.5477e-01,-3.0420e+00,-2.1405e+00,-9.7127e-02,4.3407e-01,4.4255e-03,-1.7653e+00,1.2896e-01,-3.0420e+00,-1.3309e+00,-1.7801e+00,7.9239e-02,9.5112e-02,7.9239e-02,9.7953e-02,7.9165e-02,-1.1991e+00,7.9165e-02,-9.4232e-01,7.9239e-02,-2.5413e+00,7.9239e-02,-2.9319e+00,5.4279e-01,-5.4279e-01,5.8622e-01,-5.8622e-01,1.0866e-01,-1.0866e-01,2.0460e-01,-2.0460e-01,3.8817e-01,-3.8817e-01,3.8733e-01,-3.8733e-01}
> Gradient:  {-6.9541e-07,-1.7422e-06,1.3842e-07,-4.4106e-07,7.4016e-07,-3.0693e-06,3.8831e-06,-4.1995e-06,-2.1876e-06,1.3842e-07,9.0060e-07,-3.6043e-06,-8.8104e-08,-8.0827e-07,-9.2679e-08,-2.1876e-06,-2.0346e-06,-6.7548e-07,-2.0000e-06,-1.0804e-06,8.1637e-07,-9.2679e-08,1.0377e-06,-4.5678e-06,-1.2122e-06,-9.8778e-07,-9.0812e-07,8.1637e-07,3.6231e-06,-7.2182e-06,3.6811e-06,-8.1082e-07,-4.3228e-06,-9.0812e-07,-3.1368e-06,-3.8937e-07,1.5848e-07,1.9022e-07,1.5848e-07,1.9591e-07,1.5833e-07,1.1678e-06,1.5833e-07,-3.0131e-06,1.5848e-07,-2.5812e-07,1.5848e-07,-4.9919e-07,1.3251e-06,-1.3251e-06,-4.7856e-07,4.7856e-07,5.2121e-06,-5.2121e-06,2.6955e-07,-2.6955e-07,1.8292e-06,-1.8292e-06,-2.0999e-06,2.0999e-06}
>>>> Re-trying (1/3).
Starting Function Value: 3.673343927483195
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673343926537167    0.000106669446990    6.151538554004698    0.000022669853528
         2            4    3.673343925386297    0.000089457492574    1.000000000000000    0.000021031043475
         3            5    3.673343832741562    0.001401556943905    1.000000000000000    0.000036873378685
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0921e+00,-1.2728e+00,-1.1255e+00,-1.2376e+00,-7.3824e-01,-1.1141e+00,-1.6716e+00,2.1199e-01,-2.2349e+00,-1.1255e+00,-2.0935e+00,-6.6682e-01,-2.1055e+00,-2.1518e+00,-5.6541e-01,-2.2349e+00,2.3747e+00,-3.1017e+00,-3.3656e+00,-2.7776e+00,-2.1406e+00,-5.6541e-01,1.4595e+00,-3.9504e-01,-3.3940e+00,4.5479e-01,-3.0419e+00,-2.1406e+00,-9.7601e-02,4.3471e-01,3.8775e-03,-1.7652e+00,1.2934e-01,-3.0419e+00,-1.3306e+00,-1.7801e+00,7.9220e-02,9.5089e-02,7.9220e-02,9.7930e-02,7.9146e-02,-1.1993e+00,7.9146e-02,-9.4207e-01,7.9220e-02,-2.5413e+00,7.9220e-02,-2.9318e+00,5.4280e-01,-5.4280e-01,5.8622e-01,-5.8622e-01,1.0864e-01,-1.0864e-01,2.0461e-01,-2.0461e-01,3.8819e-01,-3.8819e-01,3.8730e-01,-3.8730e-01}
> Gradient:  {1.4672e-06,8.5722e-07,7.6421e-07,3.9562e-07,2.5404e-06,3.9788e-06,3.8801e-06,3.6983e-06,-2.1633e-06,7.6421e-07,1.1972e-06,2.6270e-06,2.6937e-07,-3.6902e-07,1.9367e-07,-2.1633e-06,1.1705e-05,-4.4947e-07,-1.8148e-06,-5.7208e-07,8.3588e-07,1.9367e-07,6.7737e-06,3.7702e-06,-1.1293e-06,2.2831e-06,-9.0262e-07,8.3588e-07,3.0157e-06,5.0839e-06,9.0124e-07,2.3419e-07,8.3114e-06,-9.0262e-07,1.1668e-07,5.2575e-07,1.5844e-07,1.9018e-07,1.5844e-07,1.9586e-07,1.5829e-07,-9.6840e-08,1.5829e-07,5.6963e-06,1.5844e-07,-4.7868e-07,1.5844e-07,-1.8714e-07,3.3859e-06,-3.3859e-06,-3.0337e-07,3.0337e-07,-4.0692e-06,4.0692e-06,-9.3938e-06,9.3938e-06,1.1186e-05,-1.1186e-05,-1.5071e-05,1.5071e-05}
>>>> Re-trying (2/3).
Starting Function Value: 3.6733439181448304
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673343916331865    0.000098599604853    2.674629426038703    0.000012424093742
         2            4    3.673343916020071    0.000031266723663    1.000000000000000    0.000009658732796
         3            5    3.673343915200717    0.000137565395651    1.000000000000000    0.000010227798119
         4            6    3.673343914386301    0.000164933940267    1.000000000000000    0.000012813318197
         5            7    3.673343913794319    0.000461494065891    1.000000000000000    0.000024721026205
         6            8    3.673343912935068    0.000084247580078    1.000000000000000    0.000008800022202
         7            9    3.673343882692145    0.000045287690321    1.000000000000000    0.000007132246451
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0920e+00,-1.2727e+00,-1.1256e+00,-1.2376e+00,-7.3824e-01,-1.1141e+00,-1.6717e+00,2.1200e-01,-2.2347e+00,-1.1256e+00,-2.0936e+00,-6.6674e-01,-2.1056e+00,-2.1517e+00,-5.6542e-01,-2.2347e+00,2.3745e+00,-3.1016e+00,-3.3653e+00,-2.7775e+00,-2.1407e+00,-5.6542e-01,1.4595e+00,-3.9508e-01,-3.3939e+00,4.5489e-01,-3.0418e+00,-2.1407e+00,-9.7702e-02,4.3473e-01,4.0923e-03,-1.7651e+00,1.2894e-01,-3.0418e+00,-1.3305e+00,-1.7801e+00,7.9202e-02,9.5067e-02,7.9202e-02,9.7908e-02,7.9128e-02,-1.1991e+00,7.9128e-02,-9.4226e-01,7.9202e-02,-2.5413e+00,7.9202e-02,-2.9318e+00,5.4279e-01,-5.4279e-01,5.8622e-01,-5.8622e-01,1.0865e-01,-1.0865e-01,2.0461e-01,-2.0461e-01,3.8816e-01,-3.8816e-01,3.8734e-01,-3.8734e-01}
> Gradient:  {-6.0715e-07,-5.1956e-07,-9.3829e-08,-2.7482e-07,-6.5185e-08,3.3435e-07,3.4107e-07,2.0402e-07,-2.1673e-06,-9.3829e-08,2.5252e-07,2.3737e-07,1.2518e-07,-5.8615e-07,3.3618e-08,-2.1673e-06,1.1515e-06,-5.9953e-07,-1.8424e-06,-8.2045e-07,8.1234e-07,3.3618e-08,9.9464e-08,-3.2538e-07,-1.2380e-06,-2.8121e-07,-9.0402e-07,8.1234e-07,-1.7099e-07,-2.6088e-07,2.5125e-06,-9.4041e-08,-3.5680e-06,-9.0402e-07,-6.1125e-08,7.1963e-08,1.5840e-07,1.9013e-07,1.5840e-07,1.9582e-07,1.5826e-07,1.2913e-06,1.5826e-07,-1.0877e-06,1.5840e-07,-3.1478e-07,1.5840e-07,-5.7011e-07,-6.4630e-07,6.4630e-07,3.9144e-08,-3.9144e-08,-7.0092e-07,7.0092e-07,1.2618e-06,-1.2618e-06,-2.5092e-07,2.5092e-07,-9.5010e-07,9.5010e-07}
>>>> Re-trying (3/3).
After: gradient norm = 7.135197349314042E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5862,-0.5862}

Count Table 2:
---------------
h:                 {0.1087,-0.1087}

Count Table 3:
---------------
h:                 {0.2046,-0.2046}

Count Table 4:
---------------
h:                 {0.3882,-0.3882}

Count Table 5:
---------------
h:                 {0.3873,-0.3873}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-1.2727,-2.0920,-1.1141,-0.7382,-1.1256,-1.2376,0.2120,-1.6717,-0.6667,-2.0936,-2.2347,-1.1256,-2.1517,-2.1056,-3.1016,2.3745,-0.5654,-2.2347,-2.7775,-3.3653,-0.3951,1.4595,-2.1407,-0.5654,0.4549,-3.3939,0.4347,-0.0977,-3.0418,-2.1407,-1.7651,0.0041,-1.7801,-1.3305,0.1289,-3.0418,-1.3305,-1.7801,0.0041,-1.7651,-3.0418,0.1289,-0.0977,0.4347,-3.3939,0.4549,-2.1407,-3.0418,1.4595,-0.3951,-3.3653,-2.7775,-0.5654,-2.1407,2.3745,-3.1016,-2.1056,-2.1517,-2.2347,-0.5654,-2.0936,-0.6667,-1.6717,0.2120,-1.1256,-2.2347,-0.7382,-1.1141,-2.0920,-1.2727,-1.2376,-1.1256}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0792,0.0951}
Activity(exp=1):   {0.0792,0.0979}
Activity(exp=2):   {0.0791,-1.1991}
Activity(exp=3):   {0.0791,-0.9423}
Activity(exp=4):   {0.0792,-2.5413}
Activity(exp=5):   {0.0792,-2.9318}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;10;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component2-2-variation7).
>>  Starting new optimization: component2-2-variation7. (2021-05-21 18:33:31.551).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.6733439137221797
gradient      = {-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 7.143759264994898E-6
Starting Function Value: 3.6733439137221797
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            4    3.673343913645062    0.000011504686149    1.610452665336073    0.000006498256080
         2            5    3.673343912907333    0.000160383256847    1.000000000000000    0.000011703264753
         3            6    3.673343912136638    0.000228557659726    1.000000000000000    0.000013437977414
         4            8    3.673343911977610    0.000037792688764    0.075910070170561    0.000012905535374
         5           12    3.673343855896155    0.000375044007676    0.501655461537639    0.000009254240198
         6           13    3.673343681534870    0.000812944104895    1.000000000000000    0.000025373335944
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0918e+00,-1.2726e+00,-1.1256e+00,-1.2376e+00,-7.3820e-01,-1.1141e+00,-1.6718e+00,2.1198e-01,-2.2340e+00,-1.1256e+00,-2.0937e+00,-6.6675e-01,-2.1056e+00,-2.1515e+00,-5.6544e-01,-2.2340e+00,2.3743e+00,-3.1014e+00,-3.3648e+00,-2.7772e+00,-2.1409e+00,-5.6544e-01,1.4596e+00,-3.9495e-01,-3.3935e+00,4.5501e-01,-3.0415e+00,-2.1409e+00,-9.7648e-02,4.3488e-01,3.7901e-03,-1.7650e+00,1.2947e-01,-3.0415e+00,-1.3304e+00,-1.7800e+00,7.9152e-02,9.5007e-02,7.9152e-02,9.7846e-02,7.9078e-02,-1.1993e+00,7.9078e-02,-9.4214e-01,7.9152e-02,-2.5411e+00,7.9152e-02,-2.9316e+00,5.4277e-01,-5.4277e-01,5.8623e-01,-5.8623e-01,1.0862e-01,-1.0862e-01,2.0462e-01,-2.0462e-01,3.8817e-01,-3.8817e-01,3.8734e-01,-3.8734e-01}
> Gradient:  {1.0502e-06,9.2204e-07,4.7626e-07,2.2395e-07,1.3193e-06,1.5121e-06,1.7735e-06,2.6580e-06,-2.1309e-06,4.7626e-07,5.8044e-07,2.1467e-06,3.6595e-07,-2.1002e-07,1.9745e-07,-2.1309e-06,6.7937e-06,-3.2782e-07,-1.6793e-06,-5.5475e-07,8.0374e-07,1.9745e-07,3.9000e-06,2.0212e-06,-1.0760e-06,1.7997e-06,-9.0040e-07,8.0374e-07,9.1527e-07,3.1461e-06,-2.0076e-06,-2.9192e-07,8.2173e-06,-9.0040e-07,-1.8824e-07,-1.4071e-07,1.5830e-07,1.9001e-07,1.5830e-07,1.9569e-07,1.5816e-07,-6.7686e-07,1.5816e-07,4.1293e-06,1.5830e-07,-3.9474e-07,1.5830e-07,-3.7434e-07,-6.9039e-06,6.9039e-06,1.0356e-06,-1.0356e-06,-1.2752e-05,1.2752e-05,-2.4575e-06,2.4575e-06,-8.9097e-08,8.9097e-08,-8.7813e-07,8.7813e-07}
>>>> Re-trying (1/3).
Starting Function Value: 3.673344097121335
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            5    3.673343845596039    0.000031464971517    1.242388141241230    0.000014067236281
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0918e+00,-1.2726e+00,-1.1256e+00,-1.2376e+00,-7.3820e-01,-1.1141e+00,-1.6718e+00,2.1198e-01,-2.2340e+00,-1.1256e+00,-2.0937e+00,-6.6675e-01,-2.1056e+00,-2.1515e+00,-5.6544e-01,-2.2340e+00,2.3742e+00,-3.1014e+00,-3.3648e+00,-2.7772e+00,-2.1409e+00,-5.6544e-01,1.4596e+00,-3.9495e-01,-3.3935e+00,4.5501e-01,-3.0415e+00,-2.1409e+00,-9.7649e-02,4.3488e-01,3.7926e-03,-1.7650e+00,1.2946e-01,-3.0415e+00,-1.3304e+00,-1.7800e+00,7.9152e-02,9.5007e-02,7.9152e-02,9.7846e-02,7.9078e-02,-1.1993e+00,7.9078e-02,-9.4215e-01,7.9152e-02,-2.5411e+00,7.9152e-02,-2.9316e+00,5.4278e-01,-5.4278e-01,5.8622e-01,-5.8622e-01,1.0863e-01,-1.0863e-01,2.0463e-01,-2.0463e-01,3.8817e-01,-3.8817e-01,3.8734e-01,-3.8734e-01}
> Gradient:  {4.0506e-07,4.8538e-07,4.0635e-07,1.6020e-07,6.6577e-07,4.6180e-07,1.0839e-06,1.6396e-06,-2.1321e-06,4.0635e-07,4.0331e-07,1.1835e-06,2.9408e-07,-2.6553e-07,1.8133e-07,-2.1321e-06,4.0583e-06,-3.6711e-07,-1.7141e-06,-6.1762e-07,8.0158e-07,1.8133e-07,2.0751e-06,1.0428e-06,-1.1131e-06,8.9772e-07,-9.0128e-07,8.0158e-07,4.0623e-07,1.6779e-06,-3.1753e-06,-5.7287e-07,7.5379e-06,-9.0128e-07,-6.2587e-07,-4.9349e-07,1.5830e-07,1.9001e-07,1.5830e-07,1.9569e-07,1.5816e-07,-1.4116e-06,1.5816e-07,3.4375e-06,1.5830e-07,-4.0485e-07,1.5830e-07,-3.9734e-07,-2.9981e-06,2.9981e-06,4.2183e-07,-4.2183e-07,-4.9153e-06,4.9153e-06,-1.6691e-07,1.6691e-07,3.9684e-08,-3.9684e-08,-3.5777e-07,3.5777e-07}
>>>> Re-trying (2/3).
Starting Function Value: 3.6733439086491315
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673343908195151    0.000063977404482    4.539869215030778    0.000014355860549
         2            4    3.673343907759764    0.000046467866242    1.000000000000000    0.000012716048636
         3            5    3.673343905722506    0.000512772106622    1.000000000000000    0.000016312482156
         4            7    3.673343905403521    0.000070723995876    0.252882770334198    0.000005927423004
         5            8    3.673343905310511    0.000036494610842    1.000000000000000    0.000005607415080
         6           14    3.673343905069783    0.000050629261389    0.336803034211890    0.000005889489122
         7           15    3.673343902723221    0.000935148427951    1.000000000000000    0.000024322837976
         8           16    3.673343899380938    0.001072165191810    1.000000000000000    0.000024738185960
         9           17    3.673343892051554    0.002317908304587    1.000000000000000    0.000038377980382
        10           18    3.673343861063066    0.012920169913535    1.000000000000000    0.000083154581032
        11           19    3.673343808616679    0.012416006495813    1.000000000000000    0.000090266113030
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0900e+00,-1.2711e+00,-1.1255e+00,-1.2363e+00,-7.3661e-01,-1.1117e+00,-1.6723e+00,2.0905e-01,-2.2196e+00,-1.1255e+00,-2.0941e+00,-6.6885e-01,-2.1069e+00,-2.1488e+00,-5.6603e-01,-2.2196e+00,2.3700e+00,-3.0983e+00,-3.3532e+00,-2.7722e+00,-2.1463e+00,-5.6603e-01,1.4612e+00,-3.9320e-01,-3.3857e+00,4.5663e-01,-3.0355e+00,-2.1463e+00,-9.4429e-02,4.3560e-01,4.4590e-03,-1.7624e+00,1.2989e-01,-3.0355e+00,-1.3284e+00,-1.7778e+00,7.8084e-02,9.3726e-02,7.8084e-02,9.6526e-02,7.8011e-02,-1.2002e+00,7.8011e-02,-9.4237e-01,7.8084e-02,-2.5387e+00,7.8084e-02,-2.9281e+00,5.4286e-01,-5.4286e-01,5.8626e-01,-5.8626e-01,1.0867e-01,-1.0867e-01,2.0475e-01,-2.0475e-01,3.8825e-01,-3.8825e-01,3.8726e-01,-3.8726e-01}
> Gradient:  {-7.0922e-06,-2.5663e-06,1.2511e-06,-4.1961e-08,1.9280e-06,1.0105e-05,5.1779e-07,-2.9990e-06,-1.5861e-06,1.2511e-06,1.0761e-06,5.3235e-06,3.1198e-07,8.4372e-07,4.5206e-08,-1.5861e-06,2.6408e-06,5.3417e-07,9.7638e-08,-4.8533e-07,3.2320e-07,4.5206e-08,8.6063e-06,-5.7972e-06,1.5885e-07,3.6218e-06,-7.6370e-07,3.2320e-07,9.1988e-06,-9.7492e-06,-5.7607e-06,7.6268e-07,7.6922e-06,-7.6370e-07,-1.3018e-06,2.1611e-06,1.5617e-07,1.8745e-07,1.5617e-07,1.9305e-07,1.5602e-07,-3.9826e-06,1.5602e-07,4.6460e-06,1.5617e-07,-1.2453e-07,1.5617e-07,1.1765e-06,3.0213e-05,-3.0213e-05,1.5539e-05,-1.5539e-05,-7.1986e-06,7.1986e-06,2.8739e-06,-2.8739e-06,1.9665e-05,-1.9665e-05,-4.6290e-05,4.6290e-05}
>>>> Re-trying (3/3).
After: gradient norm = 9.025420617976145E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5429,-0.5429}

Count Table 1:
---------------
h:                 {0.5863,-0.5863}

Count Table 2:
---------------
h:                 {0.1087,-0.1087}

Count Table 3:
---------------
h:                 {0.2047,-0.2047}

Count Table 4:
---------------
h:                 {0.3882,-0.3882}

Count Table 5:
---------------
h:                 {0.3873,-0.3873}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-1.2711,-2.0900,-1.1117,-0.7366,-1.1255,-1.2363,0.2091,-1.6723,-0.6689,-2.0941,-2.2196,-1.1255,-2.1488,-2.1069,-3.0983,2.3700,-0.5660,-2.2196,-2.7722,-3.3532,-0.3932,1.4612,-2.1463,-0.5660,0.4566,-3.3857,0.4356,-0.0944,-3.0355,-2.1463,-1.7624,0.0045,-1.7778,-1.3284,0.1299,-3.0355,-1.3284,-1.7778,0.0045,-1.7624,-3.0355,0.1299,-0.0944,0.4356,-3.3857,0.4566,-2.1463,-3.0355,1.4612,-0.3932,-3.3532,-2.7722,-0.5660,-2.1463,2.3700,-3.0983,-2.1069,-2.1488,-2.2196,-0.5660,-2.0941,-0.6689,-1.6723,0.2091,-1.1255,-2.2196,-0.7366,-1.1117,-2.0900,-1.2711,-1.2363,-1.1255}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0781,0.0937}
Activity(exp=1):   {0.0781,0.0965}
Activity(exp=2):   {0.0780,-1.2002}
Activity(exp=3):   {0.0780,-0.9424}
Activity(exp=4):   {0.0781,-2.5387}
Activity(exp=5):   {0.0781,-2.9281}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID improve.
Suggested variations:
key=12;11;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component2-2-variation8).
>>  Starting new optimization: component2-2-variation8. (2021-05-21 18:35:39.043).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[48,49]},{"h":[50,51]},{"h":[52,53]},{"h":[54,55]},{"h":[56,57]},{"h":[58,59]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[36,37],[38,39],[40,41],[42,43],[44,45],[46,47]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.673343881312914
gradient      = {-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000}
gradient norm = 9.088522737300918E-5
Gradient   = {-7.0250e-06,-2.4960e-06,1.2511e-06,-4.1857e-08,1.9527e-06,1.0361e-05,6.6393e-07,-2.8975e-06,-1.5861e-06,1.2511e-06,1.1035e-06,5.4672e-06,3.7188e-07,8.5765e-07,4.5241e-08,-1.5861e-06,2.9750e-06,5.4498e-07,1.0771e-07,-4.3248e-07,3.2320e-07,4.5241e-08,8.7813e-06,-5.6164e-06,1.6762e-07,3.7176e-06,-7.6370e-07,3.2320e-07,9.2597e-06,-9.4959e-06,-5.6025e-06,8.1256e-07,7.6917e-06,-7.6370e-07,-1.2340e-06,2.3045e-06,1.5617e-07,1.8745e-07,1.5617e-07,1.9305e-07,1.5602e-07,-3.7795e-06,1.5602e-07,4.6465e-06,1.5617e-07,-1.1818e-07,1.5617e-07,1.1760e-06,3.0184e-05,-3.0184e-05,1.5523e-05,-1.5523e-05,-1.1687e-05,1.1687e-05,2.8551e-06,-2.8551e-06,1.8895e-05,-1.8895e-05,-4.6255e-05,4.6255e-05}
pCurr      = {7.0246e-06,2.4956e-06,-1.2512e-06,4.1776e-08,-1.9534e-06,-1.0363e-05,-6.6449e-07,2.8965e-06,1.5861e-06,-1.2512e-06,-1.1037e-06,-5.4685e-06,-3.7197e-07,-8.5772e-07,-4.5260e-08,1.5861e-06,-2.9778e-06,-5.4503e-07,-1.0775e-07,4.3241e-07,-3.2320e-07,-4.5260e-08,-8.7835e-06,5.6157e-06,-1.6767e-07,-3.7188e-06,7.6370e-07,-3.2320e-07,-9.2604e-06,9.4947e-06,5.6015e-06,-8.1289e-07,-7.6926e-06,7.6370e-07,1.2336e-06,-2.3050e-06,-1.5617e-07,-1.8745e-07,-1.5617e-07,-1.9305e-07,-1.5602e-07,3.7787e-06,-1.5602e-07,-4.6469e-06,-1.5617e-07,1.1837e-07,-1.5617e-07,-1.1765e-06,-3.0213e-05,3.0213e-05,-1.5539e-05,1.5539e-05,1.1699e-05,-1.1699e-05,-2.8566e-06,2.8566e-06,-1.8910e-05,1.8910e-05,4.6292e-05,-4.6292e-05}
grad*pCur  = -8.253583803231142E-9
parameters = {-2.0900e+00,-1.2711e+00,-1.1255e+00,-1.2363e+00,-7.3661e-01,-1.1117e+00,-1.6723e+00,2.0905e-01,-2.2196e+00,-1.1255e+00,-2.0941e+00,-6.6885e-01,-2.1069e+00,-2.1488e+00,-5.6603e-01,-2.2196e+00,2.3700e+00,-3.0983e+00,-3.3532e+00,-2.7722e+00,-2.1463e+00,-5.6603e-01,1.4612e+00,-3.9320e-01,-3.3857e+00,4.5663e-01,-3.0355e+00,-2.1463e+00,-9.4429e-02,4.3560e-01,4.4590e-03,-1.7624e+00,1.2989e-01,-3.0355e+00,-1.3284e+00,-1.7778e+00,7.8084e-02,9.3726e-02,7.8084e-02,9.6526e-02,7.8011e-02,-1.2002e+00,7.8011e-02,-9.4237e-01,7.8084e-02,-2.5387e+00,7.8084e-02,-2.9281e+00,5.4286e-01,-5.4286e-01,5.8626e-01,-5.8626e-01,1.0867e-01,-1.0867e-01,2.0475e-01,-2.0475e-01,3.8825e-01,-3.8825e-01,3.8726e-01,-3.8726e-01}
|grad|/|x| = 7.609413024501902E-6
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0900e+00,-1.2711e+00,-1.1255e+00,-1.2363e+00,-7.3661e-01,-1.1117e+00,-1.6723e+00,2.0905e-01,-2.2196e+00,-1.1255e+00,-2.0941e+00,-6.6885e-01,-2.1069e+00,-2.1488e+00,-5.6603e-01,-2.2196e+00,2.3700e+00,-3.0983e+00,-3.3532e+00,-2.7722e+00,-2.1463e+00,-5.6603e-01,1.4612e+00,-3.9320e-01,-3.3857e+00,4.5663e-01,-3.0355e+00,-2.1463e+00,-9.4429e-02,4.3560e-01,4.4590e-03,-1.7624e+00,1.2989e-01,-3.0355e+00,-1.3284e+00,-1.7778e+00,7.8084e-02,9.3726e-02,7.8084e-02,9.6526e-02,7.8011e-02,-1.2002e+00,7.8011e-02,-9.4237e-01,7.8084e-02,-2.5387e+00,7.8084e-02,-2.9281e+00,5.4286e-01,-5.4286e-01,5.8626e-01,-5.8626e-01,1.0867e-01,-1.0867e-01,2.0475e-01,-2.0475e-01,3.8825e-01,-3.8825e-01,3.8726e-01,-3.8726e-01}
> Gradient:  {-7.0250e-06,-2.4960e-06,1.2511e-06,-4.1857e-08,1.9527e-06,1.0361e-05,6.6393e-07,-2.8975e-06,-1.5861e-06,1.2511e-06,1.1035e-06,5.4672e-06,3.7188e-07,8.5765e-07,4.5241e-08,-1.5861e-06,2.9750e-06,5.4498e-07,1.0771e-07,-4.3248e-07,3.2320e-07,4.5241e-08,8.7813e-06,-5.6164e-06,1.6762e-07,3.7176e-06,-7.6370e-07,3.2320e-07,9.2597e-06,-9.4959e-06,-5.6025e-06,8.1256e-07,7.6917e-06,-7.6370e-07,-1.2340e-06,2.3045e-06,1.5617e-07,1.8745e-07,1.5617e-07,1.9305e-07,1.5602e-07,-3.7795e-06,1.5602e-07,4.6465e-06,1.5617e-07,-1.1818e-07,1.5617e-07,1.1760e-06,3.0184e-05,-3.0184e-05,1.5523e-05,-1.5523e-05,-1.1687e-05,1.1687e-05,2.8551e-06,-2.8551e-06,1.8895e-05,-1.8895e-05,-4.6255e-05,4.6255e-05}
>>>> Re-trying (1/3).
Starting Function Value: 3.673343881312914
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673343870381728    0.000237570916259    2.613966242109711    0.000026833687076
         2            4    3.673343868747213    0.000069786701075    1.000000000000000    0.000024193576217
         3            5    3.673343858520959    0.000651914095676    1.000000000000000    0.000035974769392
         4            6    3.673343852356765    0.000730612866850    1.000000000000000    0.000016161182635
         5            8    3.673343851954046    0.000080844988628    0.356088948268656    0.000012682819068
         6            9    3.673343851629905    0.000055769600751    1.000000000000000    0.000009895634019
         7           10    3.673343850953557    0.000131605117955    1.000000000000000    0.000013446954009
         8           11    3.673343849683440    0.000305057964228    1.000000000000000    0.000020639344148
         9           12    3.673343797148422    0.000446450781677    1.000000000000000    0.000019348043052
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0894e+00,-1.2706e+00,-1.1256e+00,-1.2362e+00,-7.3680e-01,-1.1126e+00,-1.6727e+00,2.0942e-01,-2.2193e+00,-1.1256e+00,-2.0941e+00,-6.6893e-01,-2.1069e+00,-2.1489e+00,-5.6602e-01,-2.2193e+00,2.3700e+00,-3.0983e+00,-3.3532e+00,-2.7721e+00,-2.1463e+00,-5.6602e-01,1.4608e+00,-3.9272e-01,-3.3857e+00,4.5667e-01,-3.0353e+00,-2.1463e+00,-9.5410e-02,4.3654e-01,4.6800e-03,-1.7624e+00,1.2974e-01,-3.0353e+00,-1.3282e+00,-1.7780e+00,7.8053e-02,9.3688e-02,7.8053e-02,9.6487e-02,7.7980e-02,-1.1999e+00,7.7980e-02,-9.4264e-01,7.8053e-02,-2.5387e+00,7.8053e-02,-2.9281e+00,5.4279e-01,-5.4279e-01,5.8623e-01,-5.8623e-01,1.0872e-01,-1.0872e-01,2.0472e-01,-2.0472e-01,3.8821e-01,-3.8821e-01,3.8735e-01,-3.8735e-01}
> Gradient:  {9.8987e-07,1.2785e-07,4.6675e-07,-2.6302e-07,7.3943e-07,-3.7518e-07,2.5890e-06,8.2173e-07,-1.5863e-06,4.6675e-07,8.5723e-08,-6.9124e-07,1.4008e-07,6.2475e-07,-3.2238e-08,-1.5863e-06,1.3914e-06,3.5510e-07,4.2071e-08,-4.6882e-07,3.2032e-07,-3.2238e-08,-2.4384e-07,1.2753e-06,-1.1615e-07,-4.1641e-07,-7.7326e-07,3.2032e-07,1.5259e-07,1.7257e-06,2.6360e-07,1.2111e-07,1.1886e-06,-7.7326e-07,-2.5001e-08,1.1773e-07,1.5611e-07,1.8738e-07,1.5611e-07,1.9297e-07,1.5596e-07,-8.0664e-08,1.5596e-07,9.0525e-07,1.5611e-07,-2.1286e-07,1.5611e-07,1.5493e-07,-1.1043e-06,1.1043e-06,1.6061e-06,-1.6061e-06,-3.5240e-07,3.5240e-07,-3.8336e-07,3.8336e-07,3.2339e-06,-3.2339e-06,-1.2619e-05,1.2619e-05}
>>>> Re-trying (2/3).
Starting Function Value: 3.673343848182629
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.673343847660519    0.000053225488032    2.751591843069654    0.000004723665399
         2            4    3.673343847602899    0.000013167936825    1.000000000000000    0.000004531073269
         3            5    3.673343846869116    0.000262202407141    1.000000000000000    0.000008427226897
         4            6    3.673343846445696    0.000259691233595    1.000000000000000    0.000007640954006
         5            7    3.673343846367601    0.000170236394249    1.000000000000000    0.000012749411750
         6            8    3.673343704454965    0.000034448690219    1.000000000000000    0.000006580590811
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0895e+00,-1.2706e+00,-1.1257e+00,-1.2362e+00,-7.3686e-01,-1.1125e+00,-1.6731e+00,2.0938e-01,-2.2190e+00,-1.1257e+00,-2.0941e+00,-6.6880e-01,-2.1070e+00,-2.1490e+00,-5.6601e-01,-2.2190e+00,2.3700e+00,-3.0984e+00,-3.3532e+00,-2.7720e+00,-2.1464e+00,-5.6601e-01,1.4609e+00,-3.9281e-01,-3.3857e+00,4.5677e-01,-3.0352e+00,-2.1464e+00,-9.5403e-02,4.3642e-01,4.7046e-03,-1.7624e+00,1.2966e-01,-3.0352e+00,-1.3282e+00,-1.7780e+00,7.8026e-02,9.3656e-02,7.8026e-02,9.6454e-02,7.7953e-02,-1.1999e+00,7.7953e-02,-9.4272e-01,7.8026e-02,-2.5387e+00,7.8026e-02,-2.9281e+00,5.4279e-01,-5.4279e-01,5.8622e-01,-5.8622e-01,1.0872e-01,-1.0872e-01,2.0472e-01,-2.0472e-01,3.8821e-01,-3.8821e-01,3.8738e-01,-3.8738e-01}
> Gradient:  {-1.1867e-06,1.1369e-07,2.5104e-07,-2.8808e-07,9.8213e-08,1.5784e-06,-4.4192e-07,1.5731e-07,-1.5768e-06,2.5104e-07,2.7206e-07,1.9049e-06,2.1750e-07,6.0755e-07,-4.5699e-08,-1.5768e-06,2.1171e-07,3.6000e-07,6.6728e-08,-4.0880e-07,3.1585e-07,-4.5699e-08,1.0705e-06,-1.2244e-06,-6.2254e-08,1.0688e-06,-7.6607e-07,3.1585e-07,3.9234e-07,-1.1745e-06,5.8866e-07,3.6904e-07,-1.2125e-06,-7.6607e-07,2.7843e-07,5.1663e-07,1.5605e-07,1.8731e-07,1.5605e-07,1.9291e-07,1.5591e-07,2.3566e-07,1.5591e-07,-2.2624e-08,1.5605e-07,-8.3761e-08,1.5605e-07,7.7891e-08,-4.6843e-07,4.6843e-07,-3.8994e-07,3.8994e-07,2.1642e-06,-2.1642e-06,9.8666e-07,-9.8666e-07,1.8911e-06,-1.8911e-06,-4.1314e-07,4.1314e-07}
>>>> Re-trying (3/3).
After: gradient norm = 6.528947043530919E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5428,-0.5428}

Count Table 1:
---------------
h:                 {0.5862,-0.5862}

Count Table 2:
---------------
h:                 {0.1087,-0.1087}

Count Table 3:
---------------
h:                 {0.2047,-0.2047}

Count Table 4:
---------------
h:                 {0.3882,-0.3882}

Count Table 5:
---------------
h:                 {0.3874,-0.3874}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-1.2706,-2.0895,-1.1125,-0.7369,-1.1257,-1.2362,0.2094,-1.6731,-0.6688,-2.0941,-2.2190,-1.1257,-2.1490,-2.1070,-3.0984,2.3700,-0.5660,-2.2190,-2.7720,-3.3532,-0.3928,1.4609,-2.1464,-0.5660,0.4568,-3.3857,0.4364,-0.0954,-3.0352,-2.1464,-1.7624,0.0047,-1.7780,-1.3282,0.1297,-3.0352,-1.3282,-1.7780,0.0047,-1.7624,-3.0352,0.1297,-0.0954,0.4364,-3.3857,0.4568,-2.1464,-3.0352,1.4609,-0.3928,-3.3532,-2.7720,-0.5660,-2.1464,2.3700,-3.0984,-2.1070,-2.1490,-2.2190,-0.5660,-2.0941,-0.6688,-1.6731,0.2094,-1.1257,-2.2190,-0.7369,-1.1125,-2.0895,-1.2706,-1.2362,-1.1257}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0780,0.0937}
Activity(exp=1):   {0.0780,0.0965}
Activity(exp=2):   {0.0780,-1.1999}
Activity(exp=3):   {0.0780,-0.9427}
Activity(exp=4):   {0.0780,-2.5387}
Activity(exp=5):   {0.0780,-2.9281}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

  The Likelihood DID NOT improve. Discarding fit component2-2-variation8.
> No varitions possible for Binding mode 2.
> Unfreezing component (component2-3-f0).
>>  Starting new optimization: component2-3-f0. (2021-05-21 18:37:07.343).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[249,250]},{"h":[251,252]},{"h":[253,254]},{"h":[255,256]},{"h":[257,258]},{"h":[259,260]}],"bindingModeInteractions":[],"bindingModes":[{},{},{"mononucleotide":[1,0,5,4,2,3,7,6,11,10,8,9,13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14,10,11,6,7,9,8,4,5,0,1,3,2],"activity":[[237,238],[239,240],[241,242],[243,244],[245,246],[247,248]],"dinucleotide":[[43,42,47,46,44,45,37,36,41,40,38,39,67,66,71,70,68,69,61,60,65,64,62,63,49,48,53,52,50,51,55,54,59,58,56,57,79,78,83,82,80,81,73,72,77,76,74,75,103,102,107,106,104,105,97,96,101,100,98,99,85,84,89,88,86,87,91,90,95,94,92,93,115,114,119,118,116,117,109,108,113,112,110,111,139,138,143,142,140,141,133,132,137,136,134,135,121,120,125,124,122,123,127,126,131,130,128,129,151,150,155,154,152,153,145,144,149,148,146,147,175,174,179,178,176,177,169,168,173,172,170,171,157,156,161,160,158,159,163,162,167,166,164,165,187,186,191,190,188,189,181,180,185,184,182,183,211,210,215,214,212,213,205,204,209,208,206,207,193,192,197,196,194,195,199,198,203,202,200,201,223,222,220,226,224,225,217,216,221,220,218,219,234,236,216,222,231,227,235,234,217,223,232,228,228,227,219,225,229,230,232,231,218,224,233,229,208,214,184,190,202,196,209,215,185,191,203,197,204,210,180,186,198,192,205,211,181,187,199,193,207,213,183,189,201,195,206,212,182,188,200,194,172,178,148,154,166,160,173,179,149,155,167,161,168,174,144,150,162,156,169,175,145,151,163,157,171,177,147,153,165,159,170,176,146,152,164,158,136,142,112,118,130,124,137,143,113,119,131,125,132,138,108,114,126,120,133,139,109,115,127,121,135,141,111,117,129,123,134,140,110,116,128,122,100,106,76,82,94,88,101,107,77,83,95,89,96,102,72,78,90,84,97,103,73,79,91,85,99,105,75,81,93,87,98,104,74,80,92,86,64,70,40,46,58,52,65,71,41,47,59,53,60,66,36,42,54,48,61,67,37,43,55,49,63,69,39,45,57,51,62,68,38,44,56,50]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.673343841014609
gradient      = {-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0010,-0.0005,-0.0000,0.0000,-0.0001,-0.0004,-0.0001,0.0005,-0.0000,0.0000,-0.0002,-0.0003,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0008,0.0001,0.0000,0.0000,0.0003,0.0004,-0.0000,-0.0002,0.0000,0.0000,0.0000,0.0002,-0.0001,-0.0001,-0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0001,-0.0000,0.0000,0.0001,-0.0000,0.0001,0.0001,0.0000,0.0000,-0.0002,0.0001,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0001,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0001,0.0000,0.0000,-0.0001,0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0001,0.0002,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0001,0.0001,0.0001,0.0017,0.0000,0.0000,0.0018,-0.0035,-0.0000,-0.0016,0.0000,0.0000,-0.0015,0.0032,0.0001,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0003,-0.0003,0.0005,0.0000,-0.0007,0.0002,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0002,-0.0001,-0.0002,0.0000,-0.0002,0.0003,-0.0005,0.0004,-0.0004,0.0000,0.0010,-0.0005,0.0008,-0.0009,0.0000,0.0000,0.0004,-0.0001,-0.0005,0.0001,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0004,0.0002,-0.0003,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000}
gradient norm = 0.006387148145774515
Starting Function Value: 3.673343841014609
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            2    3.670715586563168    1.000000000000000   156.56439731424743    0.016447674584179
         2            4    3.670279860653302    0.127249357581936    0.187840327860455    0.010174659311856
         3            5    3.670069081935098    0.049938057362934    1.000000000000000    0.006209385954702
         4            6    3.669829321517531    0.058221738157061    1.000000000000000    0.005943799965274
         5            7    3.669396525681895    0.183457863308899    1.000000000000000    0.009089401335694
         6            8    3.669177005534794    0.273016362672384    1.000000000000000    0.013001766731412
         7            9    3.668932353331670    0.096733415031538    1.000000000000000    0.004660430119782
         8           10    3.668869726751107    0.036314289014551    1.000000000000000    0.003150411428713
         9           11    3.668800633182361    0.053866388519679    1.000000000000000    0.003751669318193
        10           12    3.668669251644965    0.117179903195048    1.000000000000000    0.005567595181543
        11           13    3.668548828012009    0.195481070680341    1.000000000000000    0.008330848870252
        12           14    3.668430183374780    0.103322681759159    1.000000000000000    0.004105820256376
        13           15    3.668384562926547    0.028685038302147    1.000000000000000    0.002312367919197
        14           16    3.668353676259930    0.029663811920774    1.000000000000000    0.002557526601734
        15           17    3.668308639390172    0.049922324097525    1.000000000000000    0.003791705652747
        16           18    3.668205302767303    0.141005706428254    1.000000000000000    0.005753674889837
        17           19    3.668139912734921    0.228616951398765    1.000000000000000    0.008876252582227
        18           20    3.668042577767184    0.053331843608020    1.000000000000000    0.003608823019159
        19           21    3.668013376423859    0.027627332716545    1.000000000000000    0.001738320089274
        20           22    3.667996795947377    0.023500086179224    1.000000000000000    0.001853114528663
        21           23    3.667971074599178    0.044477637737223    1.000000000000000    0.002737719187783
        22           24    3.667918171039366    0.104099005533991    1.000000000000000    0.003876488363692
        23           25    3.667849547730022    0.148340004218755    1.000000000000000    0.003571284013740
        24           27    3.667832012440194    0.060777275632577    0.237570195636126    0.004212887799022
        25           28    3.667783907609358    0.115941148928841    1.000000000000000    0.001925400939204
        26           29    3.667758720376980    0.053213692404098    1.000000000000000    0.001419670987890
        27           30    3.667732560991691    0.062195140799292    1.000000000000000    0.001969690423857
        28           31    3.667705681618063    0.073796323357581    1.000000000000000    0.001846436271504
        29           32    3.667653210610665    0.154228265991221    1.000000000000000    0.001641085157135
        30           33    3.667643725822779    0.274519336586392    1.000000000000000    0.006498711360872
        31           34    3.667588315933353    0.028644011457337    1.000000000000000    0.001242324543443
        32           35    3.667579102089937    0.017443140170631    1.000000000000000    0.000929313259207
        33           36    3.667566566984710    0.050715422234270    1.000000000000000    0.001013468976171
        34           37    3.667521919222412    0.147350107232843    1.000000000000000    0.001255595224671
        35           38    3.667451110866697    0.304857569738523    1.000000000000000    0.001243313632114
        36           39    3.667401574436020    0.381276597098712    1.000000000000000    0.001400886625690
        37           40    3.667375018940526    0.325670614435409    1.000000000000000    0.001840735328341
        38           41    3.667347242030155    0.089190079687587    1.000000000000000    0.000706931090305
        39           42    3.667334421407864    0.047446731850636    1.000000000000000    0.000578688704770
        40           43    3.667318645440976    0.084651941923028    1.000000000000000    0.000534421166609
        41           44    3.667291848107041    0.190870807853548    1.000000000000000    0.000628232051425
        42           45    3.667267136670026    0.289421972961403    1.000000000000000    0.000579409726545
        43           46    3.667246149607659    0.139597988721892    1.000000000000000    0.000475044768874
        44           47    3.667218053586760    0.207033264998260    1.000000000000000    0.000527435520351
        45           48    3.667200234116231    0.194745885076376    1.000000000000000    0.000511919267775
        46           49    3.667181682476136    0.162976262266652    1.000000000000000    0.000535310365952
        47           50    3.667156075743263    0.212013206747470    1.000000000000000    0.000564720477402
        48           51    3.667127887251609    0.253684198608095    1.000000000000000    0.000578465767518
        49           52    3.667102652829000    0.255513485250340    1.000000000000000    0.001110484945118
        50           53    3.667091785095389    0.073448412092585    1.000000000000000    0.000369227838877
        51           54    3.667088820281357    0.033744673775733    1.000000000000000    0.000271870187569
        52           55    3.667086053024360    0.022402145927114    1.000000000000000    0.000352183309439
        53           56    3.667077728105108    0.088935220193825    1.000000000000000    0.000529921928613
        54           57    3.667068397189565    0.116311127849040    1.000000000000000    0.000503073410423
        55           58    3.667060098456195    0.229443533744810    1.000000000000000    0.000643193432604
        56           59    3.667051914303775    0.086342336945958    1.000000000000000    0.000220629038935
        57           60    3.667048676294452    0.032178870442626    1.000000000000000    0.000207725333236
        58           61    3.667044434195560    0.060834858530689    1.000000000000000    0.000336279269945
        59           62    3.667036890208921    0.132242571415440    1.000000000000000    0.000444723925456
        60           63    3.667020220185996    0.322868417771104    1.000000000000000    0.000537079771481
        61           64    3.667015864661149    0.612465241722566    1.000000000000000    0.001513000720359
        62           65    3.666995664782327    0.109403126697263    1.000000000000000    0.000447556636243
        63           66    3.666989731866658    0.058909372101181    1.000000000000000    0.000240569869861
        64           67    3.666985532055825    0.093710676596680    1.000000000000000    0.000358151230127
        65           68    3.666975678392441    0.198735043118142    1.000000000000000    0.000515467513477
        66           69    3.666953678488800    0.455895118582170    1.000000000000000    0.000661316687442
        67           70    3.666921971201881    0.794854750870750    1.000000000000000    0.001107274093512
        68           71    3.666894043489112    0.366731146940579    1.000000000000000    0.000608461678668
        69           72    3.666875726569721    0.140529521046019    1.000000000000000    0.000326535435328
        70           73    3.666865261321278    0.077924442739698    1.000000000000000    0.000470425046519
        71           74    3.666848897556199    0.231478828111001    1.000000000000000    0.000722620530626
        72           75    3.666820955249119    0.276578999370526    1.000000000000000    0.000694841565575
        73           76    3.666799633877279    0.479199125359641    1.000000000000000    0.001149732031886
        74           77    3.666778027598141    0.271221471260186    1.000000000000000    0.000302514023011
        75           78    3.666773125142697    0.070020936704863    1.000000000000000    0.000299675800740
        76           79    3.666767735678952    0.068945543262801    1.000000000000000    0.000285284739595
        77           80    3.666757069603094    0.139508950961865    1.000000000000000    0.000272099219764
        78           81    3.666744328927900    0.180425867005559    1.000000000000000    0.000245665259910
        79           82    3.666727923405023    0.306241242521457    1.000000000000000    0.000393987045965
        80           83    3.666717559914275    0.221532400637619    1.000000000000000    0.000232255823241
        81           84    3.666710989751615    0.078608504596674    1.000000000000000    0.000202878392965
        82           85    3.666703637273481    0.116365027100953    1.000000000000000    0.000181520430686
        83           86    3.666695965041398    0.143477411911002    1.000000000000000    0.000194887289029
        84           87    3.666686976285051    0.256877537946873    1.000000000000000    0.000345652516323
        85           88    3.666681931241722    0.116554524691105    1.000000000000000    0.000154797320798
        86           89    3.666678425256368    0.074411278895563    1.000000000000000    0.000162203216850
        87           90    3.666673678986608    0.110584372025266    1.000000000000000    0.000212105612522
        88           91    3.666666358713536    0.191976185095455    1.000000000000000    0.000177528908605
        89           92    3.666664098710557    0.227574416977835    1.000000000000000    0.000358429201051
        90           93    3.666658436457388    0.053392647507344    1.000000000000000    0.000154233900763
        91           94    3.666655382931715    0.057137460321538    1.000000000000000    0.000108558633428
        92           95    3.666652418973850    0.083843554310361    1.000000000000000    0.000139818734385
        93           96    3.666648039783674    0.175988203285697    1.000000000000000    0.000191331763104
        94           97    3.666641638214741    0.236576405086662    1.000000000000000    0.000171606970765
        95           98    3.666632601491664    0.353058512020824    1.000000000000000    0.000310630761569
        96           99    3.666623570446481    0.287474970670115    1.000000000000000    0.000176131873185
        97          100    3.666618142160807    0.120890597237686    1.000000000000000    0.000145931189271
        98          101    3.666617619670196    0.191966445647307    1.000000000000000    0.000156559185425
        99          102    3.666601319791555    0.246797357300308    1.000000000000000    0.000197901628114
       100          103    3.666595917904598    0.231993958067230    1.000000000000000    0.000247152840438
       101          104    3.666590556771792    0.077834959627397    1.000000000000000    0.000160142286193
       102          105    3.666586666827175    0.083697935677620    1.000000000000000    0.000157298346331
       103          107    3.666585901727018    0.034888600524489    0.286135767869420    0.000585853878578
       104          108    3.666583468428462    0.086539200745928    1.000000000000000    0.000310751379722
       105          109    3.666581267884174    0.082163063536483    1.000000000000000    0.000143728275561
       106          111    3.666581015167383    0.007331048520862    0.093464825049546    0.000141624323226
       107          112    3.666577363382625    0.157626839540334    1.000000000000000    0.000814818227121
       108          114    3.666575899159835    0.053271193325002    0.391499387313546    0.000247383258013
       109          115    3.666574649201090    0.019999591523865    1.000000000000000    0.000161336599306
       110          116    3.666571959097399    0.134911246730014    1.000000000000000    0.000225617061717
       111          117    3.666571580614757    0.172921742135929    1.000000000000000    0.000569828453664
       112          118    3.666568707888685    0.113284580506851    1.000000000000000    0.000203346157997
       113          119    3.666566557310704    0.152439740864802    1.000000000000000    0.000540395105311
       114          120    3.666564308276224    0.155074190901351    1.000000000000000    0.000938406866301
       115          121    3.666560596926945    0.070857871183469    1.000000000000000    0.000673807624237
       116          122    3.666553330786671    0.245313362525977    1.000000000000000    0.000407151603928
       117          123    3.666550611215193    0.115087960205070    1.000000000000000    0.000338018648439
       118          124    3.666545508981907    0.222363918467897    1.000000000000000    0.000378727773474
       119          126    3.666544440720374    0.052548845205625    0.118182187700888    0.000831630159541
       120          127    3.666539224220218    0.159760660291189    1.000000000000000    0.000522779405900
       121          128    3.666531286815374    0.315013178546396    1.000000000000000    0.000816824320995
       122          130    3.666521652169334    0.201453345069539    0.254840959332634    0.001186595665905
       123          133    3.666508555339116    0.311303789445452    0.129542205825879    0.002749133073433
       124          135    3.666495867269086    0.401074757762294    0.253826382645917    0.005569115112399
       125          137    3.666473599989245    0.157873302354760    0.416797340237611    0.002819803744142
       126          138    3.666448089948910    0.120869041203830    1.000000000000000    0.001946684813291
       127          139    3.666401548846546    0.283058894421699    1.000000000000000    0.002572839381390
       128          140    3.666398318248213    0.089413885889137    1.000000000000000    0.004513184165136
       129          141    3.666368450311148    0.067728580705478    1.000000000000000    0.001626290786447
       130          142    3.666350854115783    0.106915209538760    1.000000000000000    0.001230015252806
       131          143    3.666343265775980    0.167186321202859    1.000000000000000    0.003322824716373
       132          144    3.666321216785797    0.180948001517384    1.000000000000000    0.001304005925015
       133          145    3.666311152836072    0.123533671953943    1.000000000000000    0.001086703621018
       134          146    3.666298272444110    0.066832915579315    1.000000000000000    0.001446176757134
       135          147    3.666271017300416    0.164645939052173    1.000000000000000    0.001954202075742
       136          149    3.666255179189779    0.130376293614426    0.456104764772800    0.001953889687548
       137          150    3.666225334110378    0.117304037966514    1.000000000000000    0.001336031541859
       138          151    3.666184657803667    0.165604047107050    1.000000000000000    0.001546380301228
       139          152    3.666161598852040    0.122978157519995    1.000000000000000    0.001388600981047
       140          153    3.666136968967616    0.131502517574876    1.000000000000000    0.001036903067100
       141          154    3.666123235659521    0.193031985022124    1.000000000000000    0.001844584439745
       142          155    3.666110995246244    0.145793466912649    1.000000000000000    0.000799917963889
       143          156    3.666106046411359    0.057063909411258    1.000000000000000    0.000547373829420
       144          157    3.666100596230906    0.072884916460230    1.000000000000000    0.000508986667202
       145          158    3.666093847986836    0.098205244842442    1.000000000000000    0.000797324292864
       146          159    3.666085007868727    0.086074141642370    1.000000000000000    0.000692651605186
       147          160    3.666077180485796    0.104187324809348    1.000000000000000    0.000585548011840
       148          161    3.666072663141374    0.075275180624522    1.000000000000000    0.000942925593289
       149          162    3.666069032898380    0.030883452141559    1.000000000000000    0.000711709827152
       150          163    3.666064140266074    0.068803758160528    1.000000000000000    0.000289874579119
       151          164    3.666062320257391    0.034906056187606    1.000000000000000    0.000385463379701
       152          165    3.666060511102518    0.040111883185934    1.000000000000000    0.000443558865205
       153          166    3.666057844644675    0.038850125045028    1.000000000000000    0.000474900167230
       154          167    3.666057404827600    0.078162722908762    1.000000000000000    0.000671942920988
       155          168    3.666054442752910    0.033710822130564    1.000000000000000    0.000233977856940
       156          169    3.666053785223846    0.016451219171801    1.000000000000000    0.000169361989600
       157          170    3.666052892343191    0.020228125135347    1.000000000000000    0.000202375246959
       158          171    3.666052043331482    0.020465465269255    1.000000000000000    0.000211622653117
       159          172    3.666050658902275    0.040172765806568    1.000000000000000    0.000221567793876
       160          173    3.666049823987547    0.041496673458803    1.000000000000000    0.000342645444005
       161          174    3.666048767100927    0.021738595201008    1.000000000000000    0.000224914055781
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.0569e+00,-6.0976e-01,-8.0162e-01,-8.7859e-01,-3.9652e-01,-7.8617e-01,-1.0269e+00,4.9420e-02,-1.3318e+00,-8.0162e-01,-7.6089e-01,-6.5779e-01,-1.0528e+00,-9.6110e-01,-5.3879e-01,-1.3318e+00,1.0252e+00,-1.7417e+00,-1.1529e+00,-8.1396e-01,-1.3399e+00,-5.3879e-01,1.5966e-01,-9.1505e-01,-1.3904e+00,3.2441e-01,-1.7849e+00,-1.3399e+00,1.5997e-01,-5.7009e-01,-1.1503e-01,-7.9794e-01,8.9380e-02,-1.7849e+00,-7.5936e-01,-1.2331e+00,-2.1217e-01,-2.4339e-01,-9.4414e-02,0.0000e+00,3.5269e-01,-1.0746e-01,-2.7130e-01,-1.9775e-01,2.7693e-01,0.0000e+00,1.3479e-01,-9.4997e-02,0.0000e+00,0.0000e+00,0.0000e+00,-3.9657e-01,0.0000e+00,0.0000e+00,-1.2869e-01,8.7105e-02,3.4063e-02,0.0000e+00,-3.3807e-01,-8.8058e-02,3.7013e-01,1.2492e-01,-3.4256e-01,0.0000e+00,-1.4261e-01,-1.4130e-01,-1.8300e-01,2.0330e-01,-4.0704e-01,0.0000e+00,-1.4059e-02,1.4735e-02,2.3535e-01,2.4626e-01,-2.1149e-01,0.0000e+00,-3.1542e-03,-6.9200e-01,-1.2652e-01,2.7932e-01,-4.1908e-01,0.0000e+00,2.3092e-01,9.5500e-03,0.0000e+00,0.0000e+00,0.0000e+00,-5.3301e-01,0.0000e+00,0.0000e+00,-4.8289e-01,-1.3875e+00,1.0479e+00,0.0000e+00,5.2349e-01,-9.7477e-02,5.6473e-01,6.8112e-01,-7.4959e-01,0.0000e+00,-8.7871e-01,3.7520e-01,-4.8516e-01,-6.9225e-03,-2.7793e-03,0.0000e+00,2.9970e-01,-2.2191e-01,1.3643e+00,-4.5622e-01,-3.7308e-02,0.0000e+00,-1.0334e-01,-1.0619e+00,3.1152e-01,8.6045e-01,3.5510e-02,0.0000e+00,-5.4389e-01,-8.5136e-01,0.0000e+00,0.0000e+00,0.0000e+00,-3.3508e-01,0.0000e+00,0.0000e+00,-1.0776e-02,-3.2957e-02,1.3990e-03,0.0000e+00,-7.7673e-01,2.8605e-01,-7.5089e-01,-7.5080e-01,-5.4991e-01,0.0000e+00,1.4011e+00,8.2275e-01,-8.6029e-01,5.6325e-01,-1.7200e-02,0.0000e+00,-3.4335e-01,3.0951e-02,1.8272e+00,-9.7361e-01,-1.6923e-02,0.0000e+00,-4.5814e-01,-3.2469e-01,6.4993e-01,2.4223e-02,1.6154e-02,0.0000e+00,-2.6878e-02,-4.7971e-01,0.0000e+00,0.0000e+00,0.0000e+00,-5.6751e-01,0.0000e+00,0.0000e+00,-1.8608e-01,4.9476e-01,-7.7300e-03,0.0000e+00,7.2747e-01,-1.3635e+00,-1.0940e+00,4.2399e-02,-1.8396e-01,0.0000e+00,-4.3358e-01,1.3029e+00,-1.3690e+00,5.7231e-01,-5.0001e-01,0.0000e+00,3.8508e-01,1.3810e-01,3.1690e-01,3.4107e-01,-9.4378e-01,0.0000e+00,7.4833e-01,-6.3447e-01,1.7327e-02,-1.6863e-02,1.1274e-02,0.0000e+00,4.1135e-02,1.0720e-01,0.0000e+00,0.0000e+00,0.0000e+00,-6.9247e-01,0.0000e+00,0.0000e+00,-6.9563e-01,2.1188e-01,4.6086e-01,0.0000e+00,-3.7448e-01,-1.7014e-01,9.2530e-02,-2.7805e-02,1.8418e-01,0.0000e+00,7.4397e-02,-1.2936e-01,1.5224e-01,-6.7197e-01,3.3009e-01,0.0000e+00,-7.7067e-01,2.3344e-01,-2.9655e-01,4.5854e-01,-9.2502e-01,0.0000e+00,-1.1414e-01,4.4674e-01,2.1167e-01,2.3748e-01,-2.0413e-01,0.0000e+00,-2.0180e-01,0.0000e+00,0.0000e+00,0.0000e+00,4.6809e-02,2.6280e-01,1.7487e-01,-5.2678e-04,-8.6116e-01,-1.6098e-01,1.8170e-01,4.9426e-02,5.9327e-02,4.9426e-02,6.1099e-02,4.9380e-02,-1.1751e+00,4.9380e-02,-7.9355e-01,4.9426e-02,-2.0718e+00,4.9426e-02,-1.8187e+00,5.4286e-01,-5.4286e-01,5.8625e-01,-5.8625e-01,1.5375e-01,-1.5375e-01,2.9106e-01,-2.9106e-01,4.0459e-01,-4.0459e-01,4.2368e-01,-4.2368e-01}
> Gradient:  {-1.6347e-05,-1.8722e-05,4.3843e-06,-1.8740e-06,-1.4623e-05,-2.2870e-05,-2.4167e-05,-2.1379e-05,4.7593e-08,4.3843e-06,-3.9146e-06,-2.5023e-05,8.0848e-06,-3.7193e-07,-5.4893e-08,4.7593e-08,-7.7840e-05,-2.0303e-07,-2.9356e-06,-8.5064e-06,-7.2406e-06,-5.4893e-08,-2.8262e-05,-2.3338e-05,-2.1524e-05,2.0295e-05,-6.7905e-06,-7.2406e-06,-1.3892e-05,-4.1185e-05,-3.7313e-05,-1.0968e-05,-9.1976e-06,-6.7905e-06,-3.9806e-07,-5.6702e-06,-5.4764e-06,-1.9263e-06,-2.1105e-07,0.0000e+00,-8.7333e-06,3.0092e-06,-3.7701e-07,3.1786e-06,-4.9605e-07,0.0000e+00,-5.1885e-06,-1.4010e-05,0.0000e+00,0.0000e+00,0.0000e+00,6.0045e-06,0.0000e+00,0.0000e+00,-3.5223e-06,-1.4630e-07,1.7599e-06,0.0000e+00,7.5949e-06,-5.7804e-06,-1.3442e-05,-1.5356e-05,9.2496e-07,0.0000e+00,1.5882e-07,1.4152e-05,1.0581e-06,-7.4297e-06,1.2651e-06,0.0000e+00,5.2680e-06,-2.1431e-05,-2.1918e-06,2.6733e-06,-2.7567e-06,0.0000e+00,-2.0013e-05,5.2868e-07,2.8188e-06,5.5851e-06,3.5035e-06,0.0000e+00,-2.9499e-05,-4.0884e-06,0.0000e+00,0.0000e+00,0.0000e+00,3.2428e-06,0.0000e+00,0.0000e+00,6.0083e-06,-3.1740e-06,-5.2755e-07,0.0000e+00,5.3033e-06,-1.6055e-06,3.3648e-06,-4.3545e-06,4.3382e-07,0.0000e+00,-8.5157e-06,8.1715e-06,1.1177e-06,1.9915e-06,1.0692e-07,0.0000e+00,-2.8527e-05,1.2507e-06,-5.4512e-07,1.2673e-05,-5.4082e-07,0.0000e+00,7.8572e-07,-1.2547e-06,7.9578e-06,3.4948e-07,1.3532e-06,0.0000e+00,4.0557e-06,-1.0995e-05,0.0000e+00,0.0000e+00,0.0000e+00,7.5995e-07,0.0000e+00,0.0000e+00,5.8941e-07,-5.5663e-07,-5.8000e-09,0.0000e+00,3.9872e-06,-7.7138e-07,9.9405e-06,-1.4107e-05,-4.7746e-06,0.0000e+00,-5.0208e-05,-2.2102e-05,-1.6051e-05,-2.8745e-06,-1.8286e-07,0.0000e+00,1.1014e-05,1.2352e-05,-1.9714e-06,-2.2669e-07,5.6074e-08,0.0000e+00,-4.3992e-06,8.4327e-06,-3.6011e-06,-6.4180e-07,-8.0056e-07,0.0000e+00,7.3188e-06,-6.7911e-06,0.0000e+00,0.0000e+00,0.0000e+00,-4.1509e-06,0.0000e+00,0.0000e+00,1.0690e-05,-3.8198e-06,1.5917e-07,0.0000e+00,-3.5428e-06,-2.7267e-06,-1.4037e-05,1.7069e-05,-4.7298e-06,0.0000e+00,6.8972e-06,-3.5565e-05,-7.7307e-06,7.2572e-06,2.8944e-06,0.0000e+00,-2.0030e-05,-5.1625e-06,-1.2169e-06,-1.0350e-05,-2.7993e-06,0.0000e+00,-8.1056e-07,-1.4732e-06,-1.9655e-05,9.5262e-06,4.1331e-06,0.0000e+00,1.3927e-05,1.1707e-05,0.0000e+00,0.0000e+00,0.0000e+00,-2.4207e-06,0.0000e+00,0.0000e+00,1.3135e-06,-3.1795e-06,-8.7110e-07,0.0000e+00,-1.1211e-06,-2.9271e-07,-7.9002e-06,8.4766e-06,-2.5398e-06,0.0000e+00,8.5728e-06,-2.0366e-05,-9.8609e-06,-1.2904e-05,-7.3074e-06,0.0000e+00,-1.9054e-05,7.3137e-06,-4.1338e-06,8.2193e-06,2.1367e-06,0.0000e+00,-8.5558e-06,-1.8121e-05,2.0361e-06,-8.6885e-07,1.8138e-06,0.0000e+00,-1.2426e-06,0.0000e+00,0.0000e+00,0.0000e+00,-4.6839e-06,-1.6970e-06,-4.7114e-06,1.9473e-08,-6.9761e-07,4.6443e-08,8.7415e-07,9.8852e-08,1.1865e-07,9.8852e-08,1.2220e-07,9.8759e-08,1.4630e-06,9.8759e-08,-3.6642e-05,9.8852e-08,-3.2384e-06,9.8852e-08,7.3220e-07,3.1031e-05,-3.1031e-05,1.3515e-05,-1.3515e-05,6.2494e-05,-6.2494e-05,6.8571e-05,-6.8571e-05,1.6108e-05,-1.6108e-05,-2.8336e-06,2.8336e-06}
>>>> Re-trying (1/3).
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.0569e+00,-6.0976e-01,-8.0162e-01,-8.7859e-01,-3.9652e-01,-7.8617e-01,-1.0269e+00,4.9420e-02,-1.3318e+00,-8.0162e-01,-7.6089e-01,-6.5779e-01,-1.0528e+00,-9.6110e-01,-5.3879e-01,-1.3318e+00,1.0252e+00,-1.7417e+00,-1.1529e+00,-8.1396e-01,-1.3399e+00,-5.3879e-01,1.5966e-01,-9.1505e-01,-1.3904e+00,3.2441e-01,-1.7849e+00,-1.3399e+00,1.5997e-01,-5.7009e-01,-1.1503e-01,-7.9794e-01,8.9380e-02,-1.7849e+00,-7.5936e-01,-1.2331e+00,-2.1217e-01,-2.4339e-01,-9.4414e-02,0.0000e+00,3.5269e-01,-1.0746e-01,-2.7130e-01,-1.9775e-01,2.7693e-01,0.0000e+00,1.3479e-01,-9.4997e-02,0.0000e+00,0.0000e+00,0.0000e+00,-3.9657e-01,0.0000e+00,0.0000e+00,-1.2869e-01,8.7105e-02,3.4063e-02,0.0000e+00,-3.3807e-01,-8.8058e-02,3.7013e-01,1.2492e-01,-3.4256e-01,0.0000e+00,-1.4261e-01,-1.4130e-01,-1.8300e-01,2.0330e-01,-4.0704e-01,0.0000e+00,-1.4059e-02,1.4735e-02,2.3535e-01,2.4626e-01,-2.1149e-01,0.0000e+00,-3.1542e-03,-6.9200e-01,-1.2652e-01,2.7932e-01,-4.1908e-01,0.0000e+00,2.3092e-01,9.5500e-03,0.0000e+00,0.0000e+00,0.0000e+00,-5.3301e-01,0.0000e+00,0.0000e+00,-4.8289e-01,-1.3875e+00,1.0479e+00,0.0000e+00,5.2349e-01,-9.7477e-02,5.6473e-01,6.8112e-01,-7.4959e-01,0.0000e+00,-8.7871e-01,3.7520e-01,-4.8516e-01,-6.9225e-03,-2.7793e-03,0.0000e+00,2.9970e-01,-2.2191e-01,1.3643e+00,-4.5622e-01,-3.7308e-02,0.0000e+00,-1.0334e-01,-1.0619e+00,3.1152e-01,8.6045e-01,3.5510e-02,0.0000e+00,-5.4389e-01,-8.5136e-01,0.0000e+00,0.0000e+00,0.0000e+00,-3.3508e-01,0.0000e+00,0.0000e+00,-1.0776e-02,-3.2957e-02,1.3990e-03,0.0000e+00,-7.7673e-01,2.8605e-01,-7.5089e-01,-7.5080e-01,-5.4991e-01,0.0000e+00,1.4011e+00,8.2275e-01,-8.6029e-01,5.6325e-01,-1.7200e-02,0.0000e+00,-3.4335e-01,3.0951e-02,1.8272e+00,-9.7361e-01,-1.6923e-02,0.0000e+00,-4.5814e-01,-3.2469e-01,6.4993e-01,2.4223e-02,1.6154e-02,0.0000e+00,-2.6878e-02,-4.7971e-01,0.0000e+00,0.0000e+00,0.0000e+00,-5.6751e-01,0.0000e+00,0.0000e+00,-1.8608e-01,4.9476e-01,-7.7300e-03,0.0000e+00,7.2747e-01,-1.3635e+00,-1.0940e+00,4.2399e-02,-1.8396e-01,0.0000e+00,-4.3358e-01,1.3029e+00,-1.3690e+00,5.7231e-01,-5.0001e-01,0.0000e+00,3.8508e-01,1.3810e-01,3.1690e-01,3.4107e-01,-9.4378e-01,0.0000e+00,7.4833e-01,-6.3447e-01,1.7327e-02,-1.6863e-02,1.1274e-02,0.0000e+00,4.1135e-02,1.0720e-01,0.0000e+00,0.0000e+00,0.0000e+00,-6.9247e-01,0.0000e+00,0.0000e+00,-6.9563e-01,2.1188e-01,4.6086e-01,0.0000e+00,-3.7448e-01,-1.7014e-01,9.2530e-02,-2.7805e-02,1.8418e-01,0.0000e+00,7.4397e-02,-1.2936e-01,1.5224e-01,-6.7197e-01,3.3009e-01,0.0000e+00,-7.7067e-01,2.3344e-01,-2.9655e-01,4.5854e-01,-9.2502e-01,0.0000e+00,-1.1414e-01,4.4674e-01,2.1167e-01,2.3748e-01,-2.0413e-01,0.0000e+00,-2.0180e-01,0.0000e+00,0.0000e+00,0.0000e+00,4.6809e-02,2.6280e-01,1.7487e-01,-5.2678e-04,-8.6116e-01,-1.6098e-01,1.8170e-01,4.9426e-02,5.9327e-02,4.9426e-02,6.1099e-02,4.9380e-02,-1.1751e+00,4.9380e-02,-7.9355e-01,4.9426e-02,-2.0718e+00,4.9426e-02,-1.8187e+00,5.4286e-01,-5.4286e-01,5.8625e-01,-5.8625e-01,1.5375e-01,-1.5375e-01,2.9106e-01,-2.9106e-01,4.0459e-01,-4.0459e-01,4.2368e-01,-4.2368e-01}
> Gradient:  {-1.6347e-05,-1.8722e-05,4.3843e-06,-1.8740e-06,-1.4623e-05,-2.2870e-05,-2.4167e-05,-2.1379e-05,4.7593e-08,4.3843e-06,-3.9146e-06,-2.5023e-05,8.0848e-06,-3.7193e-07,-5.4893e-08,4.7593e-08,-7.7840e-05,-2.0303e-07,-2.9356e-06,-8.5064e-06,-7.2406e-06,-5.4893e-08,-2.8262e-05,-2.3338e-05,-2.1524e-05,2.0295e-05,-6.7905e-06,-7.2406e-06,-1.3892e-05,-4.1185e-05,-3.7313e-05,-1.0968e-05,-9.1976e-06,-6.7905e-06,-3.9806e-07,-5.6702e-06,-5.4764e-06,-1.9263e-06,-2.1105e-07,0.0000e+00,-8.7333e-06,3.0092e-06,-3.7701e-07,3.1786e-06,-4.9605e-07,0.0000e+00,-5.1885e-06,-1.4010e-05,0.0000e+00,0.0000e+00,0.0000e+00,6.0045e-06,0.0000e+00,0.0000e+00,-3.5223e-06,-1.4630e-07,1.7599e-06,0.0000e+00,7.5949e-06,-5.7804e-06,-1.3442e-05,-1.5356e-05,9.2496e-07,0.0000e+00,1.5882e-07,1.4152e-05,1.0581e-06,-7.4297e-06,1.2651e-06,0.0000e+00,5.2680e-06,-2.1431e-05,-2.1918e-06,2.6733e-06,-2.7567e-06,0.0000e+00,-2.0013e-05,5.2868e-07,2.8188e-06,5.5851e-06,3.5035e-06,0.0000e+00,-2.9499e-05,-4.0884e-06,0.0000e+00,0.0000e+00,0.0000e+00,3.2428e-06,0.0000e+00,0.0000e+00,6.0083e-06,-3.1740e-06,-5.2755e-07,0.0000e+00,5.3033e-06,-1.6055e-06,3.3648e-06,-4.3545e-06,4.3382e-07,0.0000e+00,-8.5157e-06,8.1715e-06,1.1177e-06,1.9915e-06,1.0692e-07,0.0000e+00,-2.8527e-05,1.2507e-06,-5.4512e-07,1.2673e-05,-5.4082e-07,0.0000e+00,7.8572e-07,-1.2547e-06,7.9578e-06,3.4948e-07,1.3532e-06,0.0000e+00,4.0557e-06,-1.0995e-05,0.0000e+00,0.0000e+00,0.0000e+00,7.5995e-07,0.0000e+00,0.0000e+00,5.8941e-07,-5.5663e-07,-5.8000e-09,0.0000e+00,3.9872e-06,-7.7138e-07,9.9405e-06,-1.4107e-05,-4.7746e-06,0.0000e+00,-5.0208e-05,-2.2102e-05,-1.6051e-05,-2.8745e-06,-1.8286e-07,0.0000e+00,1.1014e-05,1.2352e-05,-1.9714e-06,-2.2669e-07,5.6074e-08,0.0000e+00,-4.3992e-06,8.4327e-06,-3.6011e-06,-6.4180e-07,-8.0056e-07,0.0000e+00,7.3188e-06,-6.7911e-06,0.0000e+00,0.0000e+00,0.0000e+00,-4.1509e-06,0.0000e+00,0.0000e+00,1.0690e-05,-3.8198e-06,1.5917e-07,0.0000e+00,-3.5428e-06,-2.7267e-06,-1.4037e-05,1.7069e-05,-4.7298e-06,0.0000e+00,6.8972e-06,-3.5565e-05,-7.7307e-06,7.2572e-06,2.8944e-06,0.0000e+00,-2.0030e-05,-5.1625e-06,-1.2169e-06,-1.0350e-05,-2.7993e-06,0.0000e+00,-8.1056e-07,-1.4732e-06,-1.9655e-05,9.5262e-06,4.1331e-06,0.0000e+00,1.3927e-05,1.1707e-05,0.0000e+00,0.0000e+00,0.0000e+00,-2.4207e-06,0.0000e+00,0.0000e+00,1.3135e-06,-3.1795e-06,-8.7110e-07,0.0000e+00,-1.1211e-06,-2.9271e-07,-7.9002e-06,8.4766e-06,-2.5398e-06,0.0000e+00,8.5728e-06,-2.0366e-05,-9.8609e-06,-1.2904e-05,-7.3074e-06,0.0000e+00,-1.9054e-05,7.3137e-06,-4.1338e-06,8.2193e-06,2.1367e-06,0.0000e+00,-8.5558e-06,-1.8121e-05,2.0361e-06,-8.6885e-07,1.8138e-06,0.0000e+00,-1.2426e-06,0.0000e+00,0.0000e+00,0.0000e+00,-4.6839e-06,-1.6970e-06,-4.7114e-06,1.9473e-08,-6.9761e-07,4.6443e-08,8.7415e-07,9.8852e-08,1.1865e-07,9.8852e-08,1.2220e-07,9.8759e-08,1.4630e-06,9.8759e-08,-3.6642e-05,9.8852e-08,-3.2384e-06,9.8852e-08,7.3220e-07,3.1031e-05,-3.1031e-05,1.3515e-05,-1.3515e-05,6.2494e-05,-6.2494e-05,6.8571e-05,-6.8571e-05,1.6108e-05,-1.6108e-05,-2.8336e-06,2.8336e-06}
>>>> Re-trying (2/3).
Starting Function Value: 3.6660488264604494
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.666048778732836    0.000389720299412    1.732753416910799    0.000120753009735
         2            4    3.666048754677890    0.000236371026078    1.000000000000000    0.000125401952009
         3            5    3.666048191116330    0.004896668784115    1.000000000000000    0.000295437654063
         4            6    3.666048036175048    0.005171037786907    1.000000000000000    0.000316084134289
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.0571e+00,-6.0912e-01,-8.0220e-01,-8.7858e-01,-3.9683e-01,-7.8638e-01,-1.0261e+00,4.9014e-02,-1.3318e+00,-8.0220e-01,-7.6145e-01,-6.5755e-01,-1.0544e+00,-9.6147e-01,-5.3883e-01,-1.3318e+00,1.0269e+00,-1.7419e+00,-1.1536e+00,-8.1358e-01,-1.3392e+00,-5.3883e-01,1.5834e-01,-9.1462e-01,-1.3895e+00,3.2076e-01,-1.7842e+00,-1.3392e+00,1.5979e-01,-5.6912e-01,-1.1438e-01,-7.9777e-01,8.9030e-02,-1.7842e+00,-7.6063e-01,-1.2335e+00,-2.1230e-01,-2.4370e-01,-9.4394e-02,0.0000e+00,3.5311e-01,-1.0789e-01,-2.7148e-01,-1.9849e-01,2.7698e-01,0.0000e+00,1.3514e-01,-9.4005e-02,0.0000e+00,0.0000e+00,0.0000e+00,-3.9731e-01,0.0000e+00,0.0000e+00,-1.2837e-01,8.7035e-02,3.3890e-02,0.0000e+00,-3.3883e-01,-8.7539e-02,3.7101e-01,1.2574e-01,-3.4265e-01,0.0000e+00,-1.4276e-01,-1.4317e-01,-1.8340e-01,2.0322e-01,-4.0716e-01,0.0000e+00,-1.4769e-02,1.5679e-02,2.3532e-01,2.4591e-01,-2.1122e-01,0.0000e+00,-2.4899e-03,-6.9206e-01,-1.2701e-01,2.7861e-01,-4.1944e-01,0.0000e+00,2.3175e-01,9.8925e-03,0.0000e+00,0.0000e+00,0.0000e+00,-5.3334e-01,0.0000e+00,0.0000e+00,-4.8349e-01,-1.3872e+00,1.0479e+00,0.0000e+00,5.2283e-01,-9.7321e-02,5.6404e-01,6.8145e-01,-7.4964e-01,0.0000e+00,-8.7826e-01,3.7430e-01,-4.8534e-01,-7.1989e-03,-2.8043e-03,0.0000e+00,3.0051e-01,-2.2210e-01,1.3637e+00,-4.5750e-01,-3.7256e-02,0.0000e+00,-1.0363e-01,-1.0618e+00,3.1062e-01,8.6027e-01,3.5376e-02,0.0000e+00,-5.4440e-01,-8.5032e-01,0.0000e+00,0.0000e+00,0.0000e+00,-3.3520e-01,0.0000e+00,0.0000e+00,-1.0835e-02,-3.2903e-02,1.3996e-03,0.0000e+00,-7.7712e-01,2.8612e-01,-7.5211e-01,-7.4963e-01,-5.4945e-01,0.0000e+00,1.4023e+00,8.2320e-01,-8.5873e-01,5.6348e-01,-1.7182e-02,0.0000e+00,-3.4451e-01,2.9643e-02,1.8267e+00,-9.7364e-01,-1.6929e-02,0.0000e+00,-4.5789e-01,-3.2554e-01,6.5014e-01,2.4136e-02,1.6232e-02,0.0000e+00,-2.7722e-02,-4.7908e-01,0.0000e+00,0.0000e+00,0.0000e+00,-5.6711e-01,0.0000e+00,0.0000e+00,-1.8714e-01,4.9511e-01,-7.7457e-03,0.0000e+00,7.2779e-01,-1.3632e+00,-1.0929e+00,3.9863e-02,-1.8350e-01,0.0000e+00,-4.3487e-01,1.3041e+00,-1.3683e+00,5.7102e-01,-5.0029e-01,0.0000e+00,3.8645e-01,1.3796e-01,3.1647e-01,3.4195e-01,-9.4353e-01,0.0000e+00,7.4795e-01,-6.3433e-01,1.8616e-02,-1.8063e-02,1.0596e-02,0.0000e+00,3.9493e-02,1.0585e-01,0.0000e+00,0.0000e+00,0.0000e+00,-6.9223e-01,0.0000e+00,0.0000e+00,-6.9576e-01,2.1219e-01,4.6094e-01,0.0000e+00,-3.7437e-01,-1.7011e-01,9.2806e-02,-2.8843e-02,1.8412e-01,0.0000e+00,7.3316e-02,-1.2764e-01,1.5188e-01,-6.7100e-01,3.3018e-01,0.0000e+00,-7.6913e-01,2.3225e-01,-2.9663e-01,4.5674e-01,-9.2524e-01,0.0000e+00,-1.1378e-01,4.4798e-01,2.1127e-01,2.3743e-01,-2.0431e-01,0.0000e+00,-2.0173e-01,0.0000e+00,0.0000e+00,0.0000e+00,4.6642e-02,2.6297e-01,1.7533e-01,-5.2870e-04,-8.6116e-01,-1.6104e-01,1.8150e-01,4.9416e-02,5.9315e-02,4.9416e-02,6.1087e-02,4.9370e-02,-1.1766e+00,4.9370e-02,-7.9218e-01,4.9416e-02,-2.0716e+00,4.9416e-02,-1.8188e+00,5.4263e-01,-5.4263e-01,5.8615e-01,-5.8615e-01,1.5336e-01,-1.5336e-01,2.9071e-01,-2.9071e-01,4.0450e-01,-4.0450e-01,4.2368e-01,-4.2368e-01}
> Gradient:  {2.8877e-05,1.7074e-05,4.3372e-06,2.4088e-06,2.4150e-05,3.9334e-05,3.1154e-05,3.2259e-05,2.1686e-07,4.3372e-06,1.0580e-05,3.7634e-05,1.9776e-05,6.5474e-06,1.8799e-07,2.1686e-07,8.5120e-05,4.0471e-06,1.2041e-05,2.7665e-06,-6.9712e-06,1.8799e-07,7.2555e-05,3.5316e-05,6.6913e-07,7.2901e-07,-6.5983e-06,-6.9712e-06,3.8802e-05,8.9265e-05,5.1249e-05,1.4207e-05,2.2870e-05,-6.5983e-06,1.6281e-05,1.7888e-05,1.8913e-05,8.9354e-06,-1.9187e-07,0.0000e+00,-2.2340e-06,6.4624e-06,7.0782e-06,1.2922e-05,-4.2927e-07,0.0000e+00,-1.7403e-06,1.0726e-06,0.0000e+00,0.0000e+00,0.0000e+00,5.9567e-06,0.0000e+00,0.0000e+00,-2.6184e-06,1.4410e-06,1.7622e-06,0.0000e+00,7.6868e-06,-4.0838e-06,1.3805e-06,5.8064e-07,9.5822e-07,0.0000e+00,2.5412e-06,1.9749e-05,8.8076e-06,8.0794e-06,1.3116e-06,0.0000e+00,7.3397e-06,1.5396e-05,3.7936e-06,4.5719e-06,-2.4699e-06,0.0000e+00,2.6980e-05,6.8500e-07,4.6433e-06,7.6762e-06,3.3837e-06,0.0000e+00,1.9185e-05,-2.9305e-06,0.0000e+00,0.0000e+00,0.0000e+00,3.4108e-06,0.0000e+00,0.0000e+00,5.9995e-06,-3.1732e-06,-5.8185e-07,0.0000e+00,5.2094e-06,-1.4971e-06,6.2122e-06,-3.2488e-06,4.8551e-07,0.0000e+00,4.6266e-07,9.6818e-06,2.1593e-06,3.8134e-06,1.8515e-07,0.0000e+00,2.9872e-05,2.5663e-06,8.0034e-06,1.3132e-05,-5.2260e-07,0.0000e+00,3.3029e-06,-1.1082e-06,9.7537e-06,3.2398e-06,1.3828e-06,0.0000e+00,5.3761e-06,-1.0113e-05,0.0000e+00,0.0000e+00,0.0000e+00,1.0025e-06,0.0000e+00,0.0000e+00,6.0878e-07,-5.3282e-07,-5.9597e-09,0.0000e+00,4.0356e-06,-6.9470e-07,1.4114e-05,-7.7461e-06,-4.5613e-06,0.0000e+00,4.5874e-05,3.4030e-05,-1.5613e-05,-1.3376e-06,-1.7567e-07,0.0000e+00,1.1863e-05,1.3768e-05,7.6467e-06,1.9065e-07,6.6218e-08,0.0000e+00,1.5452e-07,8.8081e-06,2.7328e-07,1.7074e-06,-7.9486e-07,0.0000e+00,1.0744e-05,-5.1739e-06,0.0000e+00,0.0000e+00,0.0000e+00,-3.8828e-06,0.0000e+00,0.0000e+00,1.0729e-05,-3.8931e-06,1.6068e-07,0.0000e+00,-3.3035e-06,-2.6905e-06,-6.6087e-06,-6.6106e-06,-4.5876e-06,0.0000e+00,2.2806e-05,6.5454e-05,-6.4991e-06,8.6775e-06,2.9253e-06,0.0000e+00,8.5377e-06,2.2241e-05,9.1610e-06,-6.4365e-06,-1.6732e-06,0.0000e+00,5.7635e-06,-1.2737e-06,-1.6435e-05,9.3716e-06,-6.7920e-06,0.0000e+00,4.5827e-06,9.3444e-06,0.0000e+00,0.0000e+00,0.0000e+00,-2.2302e-06,0.0000e+00,0.0000e+00,1.3420e-06,-3.1486e-06,-7.1538e-07,0.0000e+00,-1.0878e-06,-2.7304e-07,1.0913e-05,1.4727e-05,8.9649e-06,0.0000e+00,1.4381e-05,-1.0047e-05,4.6261e-05,2.2289e-06,2.2899e-05,0.0000e+00,-5.4469e-06,2.2696e-05,9.8276e-06,1.8871e-05,2.2137e-06,0.0000e+00,8.4358e-06,5.3170e-06,5.7039e-06,1.5822e-06,1.8542e-06,0.0000e+00,-2.3141e-07,0.0000e+00,0.0000e+00,0.0000e+00,1.1350e-05,-1.6655e-06,-4.6703e-06,1.9706e-08,1.1363e-06,8.9643e-07,2.9060e-06,9.8832e-08,1.1863e-07,9.8832e-08,1.2217e-07,9.8740e-08,3.4362e-05,9.8740e-08,2.0031e-05,9.8832e-08,8.1166e-07,9.8832e-08,2.2711e-07,-7.4353e-05,7.4353e-05,-3.5663e-05,3.5663e-05,-8.4445e-05,8.4445e-05,-8.3117e-05,8.3117e-05,-2.2661e-05,2.2661e-05,1.8695e-05,-1.8695e-05}
>>>> Re-trying (3/3).
After: gradient norm = 3.1607249718263694E-4
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.5426,-0.5426}

Count Table 1:
---------------
h:                 {0.5861,-0.5861}

Count Table 2:
---------------
h:                 {0.1534,-0.1534}

Count Table 3:
---------------
h:                 {0.2907,-0.2907}

Count Table 4:
---------------
h:                 {0.4045,-0.4045}

Count Table 5:
---------------
h:                 {0.4237,-0.4237}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,0.8802}
Activity(exp=1):   {-0.0000,1.0372}
Activity(exp=2):   {-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.2185}
Activity(exp=5):   {-0.0000,0.0446}

Binding mode 1:
---------------
Mononucleotide:    {-0.6456,-0.9703,-0.2689,-0.6460,-0.7197,-0.7896,-0.0990,-0.5821,-0.6527,-1.0189,-0.9678,-0.7197,-0.8126,-1.0237,-1.7014,0.4832,-0.0179,-0.9678,-0.9417,-0.7268,-1.4019,-0.7108,-0.2410,-0.0179,0.4132,-1.4394,-0.7872,-0.6336,-1.3521,-0.2410,-1.0914,0.0497,-1.3751,-0.4723,0.2010,-1.3521,-0.4723,-1.3751,0.0497,-1.0914,-1.3521,0.2010,-0.6336,-0.7872,-1.4394,0.4132,-0.2410,-1.3521,-0.7108,-1.4019,-0.7268,-0.9417,-0.0179,-0.2410,0.4832,-1.7014,-1.0237,-0.8126,-0.9678,-0.0179,-1.0189,-0.6527,-0.5821,-0.0990,-0.7197,-0.9678,-0.6460,-0.2689,-0.9703,-0.6456,-0.7896,-0.7197}
Dinucleotide(d=1): {-0.2494,-0.3675,0.0634,-0.0564,-0.0358,0.0000,-0.2792,-0.4087,-0.2042,-0.2276,0.1492,0.0000,-0.0264,0.0648,-0.3501,0.0136,0.0291,0.0000,0.2834,0.2621,0.0965,-0.5967,-0.6915,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,0.1726,-0.1330,-0.2583,-0.1520,-0.4191,0.0000,-0.2466,-0.4153,-0.6294,0.7179,0.4743,0.0000,-0.1357,-0.1316,-0.0195,0.0045,-0.2999,0.0000,-0.4001,-0.2097,-0.7305,0.3031,0.3845,0.0000,0.6190,0.0429,0.2128,-1.1747,-0.7191,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.6495,-0.3102,-0.5351,0.6326,0.1424,0.0000,0.0558,0.2101,-0.8115,-0.6330,0.3657,0.0000,-0.0981,0.2719,-0.2057,-0.5459,-0.4461,0.0000,0.1398,-0.2292,-1.4139,-0.7996,0.6012,0.0000,-0.4267,-1.1169,2.2366,1.8635,-2.0732,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-0.6128,0.1369,-1.2074,-0.5959,1.3111,0.0000,-0.8165,0.2395,-0.5931,0.0428,0.1853,0.0000,-0.3631,0.2089,-0.6133,-0.3221,0.3625,0.0000,0.9115,-0.6639,-0.8098,-0.2466,-0.5931,0.0000,-0.1238,-1.5692,1.9498,0.2093,-1.1770,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,0.8054,0.3450,-0.7209,-0.3171,-0.1301,0.0000,-0.8261,0.7737,-0.1115,0.4674,0.1099,0.0000,0.3643,-1.0716,0.4189,-0.2900,-0.8612,0.0000,-0.6413,0.7106,-0.5063,-0.6133,0.2630,0.0000,-0.0019,0.4750,-0.3983,-0.7154,0.0069,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0134,-0.8379,-0.7782,0.6790,0.6826,0.0000,0.0980,0.2135,-0.6003,-0.8436,0.0398,0.0000,0.9602,-0.8851,0.6487,-0.6003,-0.0817,0.0000,-0.8674,0.6505,-0.8851,0.2135,-0.4803,0.0000,0.1494,-0.8674,0.9602,0.0980,-0.8195,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.1907,-0.8195,-0.4803,-0.0817,0.0398,-0.0112,0.0000,-0.7154,-0.6133,-0.2900,0.4674,0.6790,0.0000,-0.3983,-0.5063,0.4189,-0.1115,-0.7782,0.0000,0.4750,0.7106,-1.0716,0.7737,-0.8379,0.0000,-0.0019,-0.6413,0.3643,-0.8261,0.0134,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.3524,0.0069,0.2630,-0.8612,0.1099,0.6826,0.0000,0.2093,-0.2466,-0.3221,0.0428,-0.3171,0.0000,1.9498,-0.8098,-0.6133,-0.5931,-0.7209,0.0000,-1.5692,-0.6639,0.2089,0.2395,0.3450,0.0000,-0.1238,0.9115,-0.3631,-0.8165,0.8054,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2412,-1.1770,-0.5931,0.3625,0.1853,-0.1301,0.0000,1.8635,-0.7996,-0.5459,-0.6330,-0.5959,0.0000,2.2366,-1.4139,-0.2057,-0.8115,-1.2074,0.0000,-1.1169,-0.2292,0.2719,0.2101,0.1369,0.0000,-0.4267,0.1398,-0.0981,0.0558,-0.6128,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0178,-2.0732,0.6012,-0.4461,0.3657,1.3111,0.0000,-1.1747,0.3031,0.0045,0.7179,0.6326,0.0000,0.2128,-0.7305,-0.0195,-0.6294,-0.5351,0.0000,0.0429,-0.2097,-0.1316,-0.4153,-0.3102,0.0000,0.6190,-0.4001,-0.1357,-0.2466,-0.6495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.9680,-0.7191,0.3845,-0.2999,0.4743,0.1424,0.0000,-0.5967,0.0136,-0.2276,-0.0564,-0.1520,0.0000,0.0965,-0.3501,-0.2042,0.0634,-0.2583,0.0000,0.2621,0.0648,-0.4087,-0.3675,-0.1330,0.0000,0.2834,-0.0264,-0.2792,-0.2494,0.1726,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.7198,-0.6915,0.0291,0.1492,-0.0358,-0.4191,0.0000}
Activity(exp=0):   {0.0000,-1.4412}
Activity(exp=1):   {0.0000,-1.6459}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-0.6004}
Activity(exp=5):   {0.0000,-0.4198}

Binding mode 2:
---------------
Mononucleotide:    {-0.6091,-1.0571,-0.7864,-0.3968,-0.8022,-0.8786,0.0490,-1.0261,-0.6575,-0.7615,-1.3318,-0.8022,-0.9615,-1.0544,-1.7419,1.0269,-0.5388,-1.3318,-0.8136,-1.1536,-0.9146,0.1583,-1.3392,-0.5388,0.3208,-1.3895,-0.5691,0.1598,-1.7842,-1.3392,-0.7978,-0.1144,-1.2335,-0.7606,0.0890,-1.7842,-0.7606,-1.2335,-0.1144,-0.7978,-1.7842,0.0890,0.1598,-0.5691,-1.3895,0.3208,-1.3392,-1.7842,0.1583,-0.9146,-1.1536,-0.8136,-0.5388,-1.3392,1.0269,-1.7419,-1.0544,-0.9615,-1.3318,-0.5388,-0.7615,-0.6575,-1.0261,0.0490,-0.8022,-1.3318,-0.3968,-0.7864,-1.0571,-0.6091,-0.8786,-0.8022}
Dinucleotide(d=1): {-0.1985,-0.2715,-0.0940,0.1351,0.2770,0.0000,-0.2437,-0.2123,-0.1079,0.3531,-0.0944,0.0000,0.2032,-0.1834,0.0157,-0.0148,-0.4072,0.0000,0.1257,0.3710,-0.1432,-0.1428,-0.3426,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3973,0.0870,-0.1284,-0.0875,-0.3388,0.0339,0.0000,0.2786,-0.1270,0.0099,0.2318,-0.4194,0.0000,0.2459,0.2353,-0.6921,-0.0025,-0.2112,0.0000,-0.0072,-0.4853,-0.2221,0.3005,-0.0028,0.0000,0.6814,0.5640,0.3743,-0.8783,-0.7496,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5333,-1.3872,-0.4835,-0.0973,0.5228,1.0479,0.0000,0.8603,0.3106,-0.8503,-0.5444,0.0354,0.0000,-0.4575,1.3637,-1.0618,-0.1036,-0.0373,0.0000,0.5635,-0.8587,0.0296,-0.3445,-0.0172,0.0000,-0.7496,-0.7521,0.8232,1.4023,-0.5495,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3352,-0.0329,-0.0108,0.2861,-0.7771,0.0014,0.0000,0.0241,0.6501,-0.4791,-0.0277,0.0162,0.0000,-0.9736,1.8267,-0.3255,-0.4579,-0.0169,0.0000,0.5710,-1.3683,0.1380,0.3864,-0.5003,0.0000,0.0399,-1.0929,1.3041,-0.4349,-0.1835,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5671,0.4951,-0.1871,-1.3632,0.7278,-0.0077,0.0000,-0.0181,0.0186,0.1058,0.0395,0.0106,0.0000,0.3419,0.3165,-0.6343,0.7479,-0.9435,0.0000,-0.6710,0.1519,0.2322,-0.7691,0.3302,0.0000,-0.0288,0.0928,-0.1276,0.0733,0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6922,0.2122,-0.6958,-0.1701,-0.3744,0.4609,0.0000,0.2374,0.2113,-0.1138,-0.2017,-0.2043,0.0000,0.4567,-0.2966,0.4480,-0.1138,-0.9252,0.0000,-0.8612,0.1815,-0.2966,0.2113,0.2630,0.0000,-0.1610,-0.8612,0.4567,0.2374,0.1753,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0466,0.1753,0.2630,-0.9252,-0.2043,-0.0005,0.0000,0.0733,-0.7691,0.7479,0.0395,-0.3744,0.0000,-0.1276,0.2322,-0.6343,0.1058,-0.1701,0.0000,0.0928,0.1519,0.3165,0.0186,-0.6958,0.0000,-0.0288,-0.6710,0.3419,-0.0181,0.2122,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6922,0.1841,0.3302,-0.9435,0.0106,0.4609,0.0000,-0.4349,0.3864,-0.4579,-0.0277,0.7278,0.0000,1.3041,0.1380,-0.3255,-0.4791,-1.3632,0.0000,-1.0929,-1.3683,1.8267,0.6501,-0.1871,0.0000,0.0399,0.5710,-0.9736,0.0241,0.4951,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5671,-0.1835,-0.5003,-0.0169,0.0162,-0.0077,0.0000,1.4023,-0.3445,-0.1036,-0.5444,-0.7771,0.0000,0.8232,0.0296,-1.0618,-0.8503,0.2861,0.0000,-0.7521,-0.8587,1.3637,0.3106,-0.0108,0.0000,-0.7496,0.5635,-0.4575,0.8603,-0.0329,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3352,-0.5495,-0.0172,-0.0373,0.0354,0.0014,0.0000,-0.8783,0.3005,-0.0025,0.2318,0.5228,0.0000,0.3743,-0.2221,-0.6921,0.0099,-0.0973,0.0000,0.5640,-0.4853,0.2353,-0.1270,-0.4835,0.0000,0.6814,-0.0072,0.2459,0.2786,-1.3872,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5333,-0.7496,-0.0028,-0.2112,-0.4194,1.0479,0.0000,-0.1428,-0.0148,0.3531,0.1351,-0.3388,0.0000,-0.1432,0.0157,-0.1079,-0.0940,-0.0875,0.0000,0.3710,-0.1834,-0.2123,-0.2715,-0.1284,0.0000,0.1257,0.2032,-0.2437,-0.1985,0.0870,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3973,-0.3426,-0.4072,-0.0944,0.2770,0.0339,0.0000}
Activity(exp=0):   {0.0494,0.0593}
Activity(exp=1):   {0.0494,0.0611}
Activity(exp=2):   {0.0494,-1.1766}
Activity(exp=3):   {0.0494,-0.7922}
Activity(exp=4):   {0.0494,-2.0716}
Activity(exp=5):   {0.0494,-1.8188}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}

> Optimizing the full model (component2-4-all).
>>  Starting new optimization: component2-4-all. (2021-05-21 18:48:49.939).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[510,511]},{"h":[512,513]},{"h":[514,515]},{"h":[516,517]},{"h":[518,519]},{"h":[520,521]}],"bindingModeInteractions":[],"bindingModes":[{"mononucleotide":[],"activity":[[0,1],[2,3],[4,5],[6,7],[8,9],[10,11]]},{"mononucleotide":[13,12,17,16,14,15,19,18,23,22,20,21,25,24,29,28,26,27,31,30,35,34,32,33,37,36,41,40,38,39,43,42,47,46,44,45,46,47,42,43,45,44,40,41,36,37,39,38,34,35,30,31,33,32,28,29,24,25,27,26,22,23,18,19,21,20,16,17,12,13,15,14],"activity":[[249,250],[251,252],[253,254],[255,256],[257,258],[259,260]],"dinucleotide":[[55,54,59,58,56,57,49,48,53,52,50,51,79,78,83,82,80,81,73,72,77,76,74,75,61,60,65,64,62,63,67,66,71,70,68,69,91,90,95,94,92,93,85,84,89,88,86,87,115,114,119,118,116,117,109,108,113,112,110,111,97,96,101,100,98,99,103,102,107,106,104,105,127,126,131,130,128,129,121,120,125,124,122,123,151,150,155,154,152,153,145,144,149,148,146,147,133,132,137,136,134,135,139,138,143,142,140,141,163,162,167,166,164,165,157,156,161,160,158,159,187,186,191,190,188,189,181,180,185,184,182,183,169,168,173,172,170,171,175,174,179,178,176,177,199,198,203,202,200,201,193,192,197,196,194,195,223,222,227,226,224,225,217,216,221,220,218,219,205,204,209,208,206,207,211,210,215,214,212,213,235,234,232,238,236,237,229,228,233,232,230,231,246,248,228,234,243,239,247,246,229,235,244,240,240,239,231,237,241,242,244,243,230,236,245,241,220,226,196,202,214,208,221,227,197,203,215,209,216,222,192,198,210,204,217,223,193,199,211,205,219,225,195,201,213,207,218,224,194,200,212,206,184,190,160,166,178,172,185,191,161,167,179,173,180,186,156,162,174,168,181,187,157,163,175,169,183,189,159,165,177,171,182,188,158,164,176,170,148,154,124,130,142,136,149,155,125,131,143,137,144,150,120,126,138,132,145,151,121,127,139,133,147,153,123,129,141,135,146,152,122,128,140,134,112,118,88,94,106,100,113,119,89,95,107,101,108,114,84,90,102,96,109,115,85,91,103,97,111,117,87,93,105,99,110,116,86,92,104,98,76,82,52,58,70,64,77,83,53,59,71,65,72,78,48,54,66,60,73,79,49,55,67,61,75,81,51,57,69,63,74,80,50,56,68,62]]},{"mononucleotide":[262,261,266,265,263,264,268,267,272,271,269,270,274,273,278,277,275,276,280,279,284,283,281,282,286,285,290,289,287,288,292,291,296,295,293,294,295,296,291,292,294,293,289,290,285,286,288,287,283,284,279,280,282,281,277,278,273,274,276,275,271,272,267,268,270,269,265,266,261,262,264,263],"activity":[[498,499],[500,501],[502,503],[504,505],[506,507],[508,509]],"dinucleotide":[[304,303,308,307,305,306,298,297,302,301,299,300,328,327,332,331,329,330,322,321,326,325,323,324,310,309,314,313,311,312,316,315,320,319,317,318,340,339,344,343,341,342,334,333,338,337,335,336,364,363,368,367,365,366,358,357,362,361,359,360,346,345,350,349,347,348,352,351,356,355,353,354,376,375,380,379,377,378,370,369,374,373,371,372,400,399,404,403,401,402,394,393,398,397,395,396,382,381,386,385,383,384,388,387,392,391,389,390,412,411,416,415,413,414,406,405,410,409,407,408,436,435,440,439,437,438,430,429,434,433,431,432,418,417,422,421,419,420,424,423,428,427,425,426,448,447,452,451,449,450,442,441,446,445,443,444,472,471,476,475,473,474,466,465,470,469,467,468,454,453,458,457,455,456,460,459,464,463,461,462,484,483,481,487,485,486,478,477,482,481,479,480,495,497,477,483,492,488,496,495,478,484,493,489,489,488,480,486,490,491,493,492,479,485,494,490,469,475,445,451,463,457,470,476,446,452,464,458,465,471,441,447,459,453,466,472,442,448,460,454,468,474,444,450,462,456,467,473,443,449,461,455,433,439,409,415,427,421,434,440,410,416,428,422,429,435,405,411,423,417,430,436,406,412,424,418,432,438,408,414,426,420,431,437,407,413,425,419,397,403,373,379,391,385,398,404,374,380,392,386,393,399,369,375,387,381,394,400,370,376,388,382,396,402,372,378,390,384,395,401,371,377,389,383,361,367,337,343,355,349,362,368,338,344,356,350,357,363,333,339,351,345,358,364,334,340,352,346,360,366,336,342,354,348,359,365,335,341,353,347,325,331,301,307,319,313,326,332,302,308,320,314,321,327,297,303,315,309,322,328,298,304,316,310,324,330,300,306,318,312,323,329,299,305,317,311]]},{}]}

Value and gradient before optimization:
=======================================
value         = 3.6660481416374577
gradient      = {-0.0000,0.0001,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0001,-0.0000,-0.0009,-0.0000,-0.0012,0.0007,0.0007,0.0001,0.0001,0.0015,0.0010,0.0004,0.0018,-0.0000,0.0001,0.0004,0.0014,0.0001,0.0001,-0.0003,-0.0000,0.0042,0.0000,0.0000,0.0004,-0.0001,-0.0003,0.0035,0.0006,0.0002,0.0008,-0.0000,-0.0001,0.0013,0.0021,0.0012,0.0006,0.0014,-0.0000,0.0002,0.0007,0.0003,0.0002,-0.0000,0.0000,0.0001,0.0001,0.0000,0.0004,-0.0000,0.0000,0.0001,0.0002,0.0000,0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,0.0001,-0.0000,0.0000,0.0000,0.0000,0.0002,0.0007,-0.0000,0.0000,0.0001,0.0004,-0.0002,0.0005,-0.0000,0.0000,0.0001,0.0006,0.0000,-0.0000,-0.0001,0.0000,0.0005,-0.0000,0.0001,0.0001,-0.0001,0.0000,0.0018,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0001,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0003,0.0000,-0.0000,0.0000,-0.0001,0.0000,0.0015,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0001,-0.0000,-0.0000,0.0001,-0.0001,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,-0.0003,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0002,-0.0000,0.0000,0.0033,0.0006,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0001,-0.0001,-0.0000,0.0000,0.0001,-0.0000,0.0000,0.0002,-0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,-0.0001,0.0000,0.0000,-0.0000,-0.0003,-0.0000,0.0000,0.0000,-0.0000,0.0001,0.0013,-0.0000,0.0000,0.0005,0.0017,-0.0000,-0.0003,-0.0000,0.0000,0.0005,0.0004,0.0001,0.0000,0.0000,0.0000,0.0001,-0.0000,0.0002,0.0003,0.0003,0.0000,-0.0003,0.0002,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0001,-0.0000,0.0002,0.0001,0.0004,0.0000,0.0004,0.0001,0.0007,0.0002,0.0007,0.0000,0.0001,0.0003,0.0004,0.0002,-0.0000,0.0000,0.0003,0.0002,0.0001,0.0001,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0007,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0009,0.0000,0.0012,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0001,0.0001,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0001,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0001,0.0001,-0.0000,0.0000,-0.0001,0.0001,-0.0001,0.0001,-0.0000,0.0000,0.0000,-0.0000}
gradient norm = 0.009117673239447897
Starting Function Value: 3.6660481416374577
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.665920679954148    0.032917951241889    3.610345575828321    0.009095262442908
         2            4    3.665831014839942    0.016558230352482    1.000000000000000    0.005327889861432
         3            5    3.665731045838405    0.034139898578300    1.000000000000000    0.005128219796550
         4            6    3.665648623850612    0.041036140489233    1.000000000000000    0.004944806353604
         5            7    3.665647677884656    0.052810712583566    1.000000000000000    0.010231411157796
         6            8    3.665583607032827    0.011634330370667    1.000000000000000    0.003008563291524
         7            9    3.665566548069259    0.007675942079545    1.000000000000000    0.002457571447455
         8           10    3.665516813069665    0.038191718870993    1.000000000000000    0.003923757727446
         9           11    3.665475535597920    0.047651537164391    1.000000000000000    0.003761847448872
        10           12    3.665399827689970    0.082125583109155    1.000000000000000    0.003435112855333
        11           13    3.665377635680570    0.281686847564165    1.000000000000000    0.012054725814846
        12           14    3.665225147670397    0.034169456461504    1.000000000000000    0.003460725865678
        13           15    3.665192862109655    0.025998857286471    1.000000000000000    0.002899983729367
        14           16    3.665134593158244    0.102501089000072    1.000000000000000    0.003113772824137
        15           18    3.665097637480951    0.091515049319825    0.447603589399158    0.004509606610227
        16           19    3.665042694014947    0.095746068014261    1.000000000000000    0.003087486332821
        17           20    3.664962901776870    0.182264936516416    1.000000000000000    0.003632325869028
        18           21    3.664957271280615    0.130254206210768    1.000000000000000    0.008495801965654
        19           22    3.664902482942959    0.037345363485827    1.000000000000000    0.002799272542812
        20           23    3.664885694372344    0.013025005998398    1.000000000000000    0.001881712835872
        21           24    3.664860730274355    0.027603390946669    1.000000000000000    0.002665854151300
        22           25    3.664830863225590    0.054667861815122    1.000000000000000    0.003157014342623
        23           26    3.664788591208398    0.092798849243260    1.000000000000000    0.002552175009471
        24           28    3.664768381182283    0.076183769018030    0.408765659594079    0.003473521803456
        25           29    3.664738031314513    0.079398260315989    1.000000000000000    0.001972377285203
        26           30    3.664714144777424    0.062387316384490    1.000000000000000    0.002558008126456
        27           31    3.664687541801351    0.089298491048627    1.000000000000000    0.002591682821972
        28           32    3.664659945822444    0.093634270111586    1.000000000000000    0.004247525965337
        29           33    3.664627843397929    0.114676648806552    1.000000000000000    0.001703853180205
        30           34    3.664606074000437    0.036960833520574    1.000000000000000    0.002104636197670
        31           35    3.664583570838794    0.049538350679572    1.000000000000000    0.002695265577790
        32           36    3.664550021633231    0.097804433054960    1.000000000000000    0.002324719002934
        33           37    3.664505039643753    0.221977435536999    1.000000000000000    0.002892729259568
        34           38    3.664469400405813    0.188361885379028    1.000000000000000    0.002198694544807
        35           39    3.664447453644050    0.079370599383380    1.000000000000000    0.001690564421020
        36           40    3.664417486928958    0.126859632497862    1.000000000000000    0.001497104242819
        37           41    3.664387843116856    0.138631134988108    1.000000000000000    0.001568762279823
        38           42    3.664328777308830    0.292458092606850    1.000000000000000    0.001992689157835
        39           43    3.664252779039559    0.357579077387961    1.000000000000000    0.002547087763283
        40           44    3.664142686642101    0.480656198805108    1.000000000000000    0.003725515318032
        41           45    3.664111887459295    0.514147937631166    1.000000000000000    0.006811990286794
        42           46    3.663951140229138    0.296283672817472    1.000000000000000    0.002966250318544
        43           47    3.663912745712896    0.334460281224949    1.000000000000000    0.001791126818674
        44           48    3.663840340932527    0.165986318311120    1.000000000000000    0.001709936346475
        45           49    3.663702136434386    0.502704772971004    1.000000000000000    0.003421533456355
        46           50    3.663630748656450    0.116945840292166    1.000000000000000    0.001735464198821
        47           51    3.663565285204394    0.167177989348968    1.000000000000000    0.001656077486173
        48           52    3.663525316832149    0.089678022307652    1.000000000000000    0.001996957760048
        49           53    3.663419060692970    0.278726578071686    1.000000000000000    0.002089323218450
        50           54    3.663289901946650    0.395252811228121    1.000000000000000    0.002717036190167
        51           55    3.663201956716605    0.508444824636078    1.000000000000000    0.002118817667961
        52           56    3.663159018433998    0.096433017915731    1.000000000000000    0.001215621611635
        53           57    3.663141550040781    0.040432076278115    1.000000000000000    0.000919115729509
        54           58    3.663117075561825    0.072798086085148    1.000000000000000    0.001119332071088
        55           59    3.663080174115930    0.129621644102002    1.000000000000000    0.001867661382609
        56           60    3.663033008155991    0.241832098210230    1.000000000000000    0.001421308366882
        57           61    3.662991130433988    0.233729769720394    1.000000000000000    0.001531910445382
        58           62    3.662941702930858    0.377919350209694    1.000000000000000    0.001885032015578
        59           63    3.662921286408748    0.095204721087963    1.000000000000000    0.001209644880382
        60           64    3.662903139204178    0.085345642893035    1.000000000000000    0.000889154830333
        61           65    3.662883889997745    0.095595612395559    1.000000000000000    0.000925272303702
        62           66    3.662856675438866    0.157698615575991    1.000000000000000    0.001269792953004
        63           67    3.662831231682640    0.164519550176499    1.000000000000000    0.001488513120509
        64           68    3.662797076393572    0.229018434549319    1.000000000000000    0.001531160976708
        65           69    3.662746163587930    0.377383459521572    1.000000000000000    0.001348793933331
        66           70    3.662694666947313    0.506783858621528    1.000000000000000    0.001936022181043
        67           71    3.662654746669487    0.354084300838409    1.000000000000000    0.000930979404206
        68           72    3.662631543787442    0.096766743878502    1.000000000000000    0.001105649056017
        69           73    3.662604285650005    0.144317897314849    1.000000000000000    0.001005557204661
        70           74    3.662567567815063    0.179488565416150    1.000000000000000    0.001078144551344
        71           75    3.662523027786349    0.380373974043252    1.000000000000000    0.002396755786496
        72           76    3.662504784258495    0.227275642758920    1.000000000000000    0.000687113603062
        73           77    3.662496633377984    0.099494389580210    1.000000000000000    0.000731593110640
        74           78    3.662489202209827    0.045744770098207    1.000000000000000    0.000683091389525
        75           79    3.662471548052083    0.126486949609310    1.000000000000000    0.000584255757492
        76           80    3.662451007558666    0.146382368151524    1.000000000000000    0.000683543982123
        77           81    3.662431391805471    0.172345562420779    1.000000000000000    0.000650689516546
        78           82    3.662414347620846    0.182079272635447    1.000000000000000    0.000868722602190
        79           83    3.662398571536356    0.141299841344956    1.000000000000000    0.000644467135786
        80           84    3.662379627138880    0.177375709980356    1.000000000000000    0.000679660498155
        81           85    3.662364082640579    0.154936415916905    1.000000000000000    0.000750397009370
        82           86    3.662347374215910    0.173884583093378    1.000000000000000    0.000705123956394
        83           87    3.662330655005972    0.202425193396562    1.000000000000000    0.000676299495070
        84           88    3.662315632135213    0.174081400628017    1.000000000000000    0.000594560314204
        85           89    3.662298225748200    0.177361734855590    1.000000000000000    0.000636069611229
        86           90    3.662276505056504    0.226688717512308    1.000000000000000    0.000592635971583
        87           91    3.662255012614944    0.290464928204181    1.000000000000000    0.000651171557258
        88           92    3.662237618698294    0.192007076556031    1.000000000000000    0.000490432643842
        89           93    3.662224119964635    0.125116341584449    1.000000000000000    0.000488829948136
        90           94    3.662202542632083    0.193903662958591    1.000000000000000    0.000521860672245
        91           95    3.662186227444635    0.262937935956597    1.000000000000000    0.000540157945302
        92           96    3.662175828367202    0.107061051657803    1.000000000000000    0.000539038483746
        93           97    3.662168092519411    0.126365587625806    1.000000000000000    0.000429952160427
        94           98    3.662159826622303    0.083844567546868    1.000000000000000    0.000513474569918
        95           99    3.662149870387383    0.159234934997149    1.000000000000000    0.000351742114717
        96          100    3.662143678392245    0.083298398808638    1.000000000000000    0.000378715595332
        97          101    3.662136053920180    0.112903387025434    1.000000000000000    0.000446469229142
        98          102    3.662126065150559    0.150193083630919    1.000000000000000    0.000455933218588
        99          103    3.662112444433109    0.219771437763137    1.000000000000000    0.000494403331284
       100          104    3.662092853262283    0.373137121846046    1.000000000000000    0.000721145670209
       101          105    3.662079506108597    0.163349339144883    1.000000000000000    0.000415816821924
       102          106    3.662069059578758    0.140163527144547    1.000000000000000    0.000505109014918
       103          107    3.662064142698878    0.126605553630465    1.000000000000000    0.001700830050764
       104          108    3.662055846276961    0.055483817995428    1.000000000000000    0.000603154707842
       105          109    3.662048215064021    0.107569856370854    1.000000000000000    0.000909145098782
       106          110    3.662041954481735    0.096605655134277    1.000000000000000    0.001061019067363
       107          111    3.662032773351914    0.230436738128481    1.000000000000000    0.001262483795398
       108          112    3.662024090415236    0.115643538593751    1.000000000000000    0.000627885740012
       109          113    3.662019121356259    0.143666807183617    1.000000000000000    0.000686433796270
       110          114    3.662015693960556    0.091832283488374    1.000000000000000    0.001489820939775
       111          115    3.662011085842993    0.070026610844035    1.000000000000000    0.000818133232197
       112          116    3.662006526771012    0.069816086352963    1.000000000000000    0.000559197119708
       113          117    3.662001776693884    0.078553693004984    1.000000000000000    0.000773929983781
       114          118    3.661996642734546    0.110632541907487    1.000000000000000    0.001251797513289
       115          119    3.661991291700856    0.152509227196834    1.000000000000000    0.001220647313884
       116          120    3.661986522326732    0.030651655070007    1.000000000000000    0.000697797556865
       117          121    3.661980345499903    0.071159789772545    1.000000000000000    0.000882415236641
       118          122    3.661976371542948    0.046891463809394    1.000000000000000    0.000975705787300
       119          123    3.661968000451614    0.213224756503543    1.000000000000000    0.001418040305143
       120          124    3.661959178400394    0.163330048496195    1.000000000000000    0.001370578891111
       121          125    3.661948214469327    0.117689649211145    1.000000000000000    0.001587875553415
       122          126    3.661933912226315    0.580802810180073    1.000000000000000    0.001942572524119
       123          127    3.661926553898009    0.215165302532609    1.000000000000000    0.004758447195001
       124          128    3.661908853330050    0.086968929547677    1.000000000000000    0.001881853091789
       125          129    3.661897879524154    0.252298424369189    1.000000000000000    0.001115273809026
       126          130    3.661879665338090    0.264385237721700    1.000000000000000    0.001728049428995
       127          131    3.661846495861555    0.396097886002310    1.000000000000000    0.002462625487469
       128          132    3.661830819510112    0.462591199317136    1.000000000000000    0.005736215626538
       129          133    3.661786921931283    0.154147267326297    1.000000000000000    0.002352334282607
       130          134    3.661769432254690    0.454856173383141    1.000000000000000    0.003785163197291
       131          135    3.661732406276353    0.270470982215610    1.000000000000000    0.002814068207495
       132          136    3.661678311046861    0.260014301706664    1.000000000000000    0.002128292774650
       133          137    3.661549704736605    1.032029135108050    1.000000000000000    0.006958576166177
       134          138    3.661424504167601    0.252529716929126    1.000000000000000    0.006541660509818
       135          139    3.661240970131118    0.598603590771538    1.000000000000000    0.004945750834501
       136          140    3.661076294014354    0.321630639330606    1.000000000000000    0.003465017487563
       137          141    3.660941204570932    0.429041495795590    1.000000000000000    0.006606512539051
       138          142    3.660745385691116    0.282284804749919    1.000000000000000    0.005577326604436
       139          143    3.660422975334549    0.493941383602585    1.000000000000000    0.004161770289455
       140          144    3.660215823800713    0.378410760881226    1.000000000000000    0.005493398531602
       141          145    3.659964120970316    0.463972593729918    1.000000000000000    0.005083586980980
       142          146    3.659654606056611    0.652042114688572    1.000000000000000    0.003597618596975
       143          147    3.659410088111508    0.681194714549105    1.000000000000000    0.002747215050419
       144          149    3.659294194648464    0.282235043782031    0.491977159028280    0.005688808579825
       145          150    3.659106649112098    0.489607121587557    1.000000000000000    0.004765785071572
       146          151    3.658956268449658    0.249918657690019    1.000000000000000    0.003684613267192
       147          152    3.658740992043159    0.520248101903468    1.000000000000000    0.002415834745435
       148          154    3.658679959416051    0.309755983754192    0.254096147689998    0.003800388067068
       149          155    3.658584918930195    0.270330705735765    1.000000000000000    0.002619379465572
       150          156    3.658505498620467    0.378545422123346    1.000000000000000    0.001788289293551
       151          157    3.658462952440257    0.164823094939609    1.000000000000000    0.001734967736542
       152          158    3.658362725753966    0.342623525068473    1.000000000000000    0.001805666832470
       153          159    3.658284727844008    0.364289623226937    1.000000000000000    0.002340810461721
       154          160    3.658215938691954    0.257907558769742    1.000000000000000    0.001922531063955
       155          161    3.658170854154894    0.274269917807648    1.000000000000000    0.001265877773410
       156          162    3.658127356333666    0.236356312600160    1.000000000000000    0.001695774223473
       157          163    3.658077981419143    0.202275062322766    1.000000000000000    0.001333373674938
       158          164    3.658024477523301    0.249654225338963    1.000000000000000    0.001084868429238
       159          165    3.657977264069391    0.251435151028265    1.000000000000000    0.001239164918045
       160          166    3.657937904653324    0.330545762451058    1.000000000000000    0.002643984231577
       161          167    3.657904653166807    0.119010765968776    1.000000000000000    0.001189322865480
       162          168    3.657875606332570    0.087734742208178    1.000000000000000    0.001295125542645
       163          169    3.657852875287626    0.094609569801182    1.000000000000000    0.001325792176166
       164          170    3.657813610715939    0.214744458690822    1.000000000000000    0.001315886630249
       165          171    3.657786951310357    0.255871532017129    1.000000000000000    0.001475522612295
       166          172    3.657764033368565    0.141402151837986    1.000000000000000    0.000765722258241
       167          173    3.657746308208985    0.120062392564776    1.000000000000000    0.000655589910473
       168          174    3.657726615701930    0.147613844332313    1.000000000000000    0.000711130073693
       169          175    3.657696854774429    0.227774188997674    1.000000000000000    0.000769796305284
       170          176    3.657681765237735    0.341877132685048    1.000000000000000    0.001389339752285
       171          177    3.657656312508272    0.192560844927696    1.000000000000000    0.001510077088622
       172          178    3.657643791545432    0.066835579347257    1.000000000000000    0.000605821561830
       173          179    3.657633904551735    0.057442066115194    1.000000000000000    0.000631059167916
       174          180    3.657622381224154    0.173124482066099    1.000000000000000    0.001556970697622
       175          181    3.657608226451410    0.166652942929511    1.000000000000000    0.001017304980433
       176          182    3.657592933882855    0.197133421069735    1.000000000000000    0.000564762655614
       177          183    3.657580733754192    0.135466311502511    1.000000000000000    0.000667102335595
       178          184    3.657569510671726    0.106880789776916    1.000000000000000    0.000738215648580
       179          185    3.657551327521607    0.148870101766157    1.000000000000000    0.000965065750495
       180          186    3.657532846627275    0.323462309812541    1.000000000000000    0.001389717198957
       181          187    3.657520252329552    0.094088495491931    1.000000000000000    0.000853296503559
       182          188    3.657510403093336    0.088604935947673    1.000000000000000    0.000686750846253
       183          189    3.657499620814270    0.124556395688882    1.000000000000000    0.000490070343206
       184          190    3.657485123901181    0.231127145209219    1.000000000000000    0.000511250273304
       185          191    3.657473972549031    0.189007678623310    1.000000000000000    0.000815000684186
       186          192    3.657462864668341    0.215501930114060    1.000000000000000    0.000808821261626
       187          193    3.657451245983810    0.105041450457212    1.000000000000000    0.000592095949463
       188          194    3.657437762865281    0.131779497163598    1.000000000000000    0.000428703054943
       189          195    3.657431413503697    0.105722869763434    1.000000000000000    0.000561236886614
       190          196    3.657425014205554    0.075029673897814    1.000000000000000    0.000468829954485
       191          197    3.657417126850585    0.115513651443977    1.000000000000000    0.000342756964539
       192          198    3.657409660461232    0.153894399556055    1.000000000000000    0.000412810267382
       193          199    3.657401148831587    0.154467410120835    1.000000000000000    0.000471618386270
       194          200    3.657393901082690    0.217093272104750    1.000000000000000    0.000589308665900
       195          201    3.657388094958040    0.083826290321750    1.000000000000000    0.000285780939385
       196          202    3.657384623072461    0.054141461671076    1.000000000000000    0.000340262175256
       197          203    3.657380330015702    0.056045360178809    1.000000000000000    0.000372024668221
       198          204    3.657374395025564    0.117763864117453    1.000000000000000    0.000473411634946
       199          205    3.657370013219520    0.149433637445857    1.000000000000000    0.000236313217778
       200          206    3.657367471810630    0.090866375612926    1.000000000000000    0.000299268172505
       201          207    3.657364045294021    0.094785672892710    1.000000000000000    0.000349553519750
       202          208    3.657358916203676    0.116375768366789    1.000000000000000    0.000292326710697
       203          209    3.657354769948529    0.136031234803490    1.000000000000000    0.000560997741470
       204          210    3.657351754215654    0.054968681774784    1.000000000000000    0.000211891336334
       205          211    3.657349690922875    0.042331270515562    1.000000000000000    0.000270209212770
       206          212    3.657347547661175    0.050285636053804    1.000000000000000    0.000371634405963
       207          213    3.657347356561178    0.119735483157144    1.000000000000000    0.001104597270827
       208          214    3.657343933863266    0.069366544887520    1.000000000000000    0.000243523296091
       209          215    3.657343040812170    0.034625922436500    1.000000000000000    0.000265474710821
       210          216    3.657341919489068    0.063042525747697    1.000000000000000    0.000309755691667
       211          217    3.657340083721473    0.057587270326945    1.000000000000000    0.000295925238728
       212          218    3.657337081805121    0.141410553837439    1.000000000000000    0.000413912171507
       213          220    3.657335794749950    0.061453755023775    0.430258116387373    0.000394165262614
       214          221    3.657334659662990    0.033212769224735    1.000000000000000    0.000326429971085
       215          222    3.657333460314972    0.044698190950239    1.000000000000000    0.000456890341093
       216          223    3.657332831126154    0.028348649100386    1.000000000000000    0.000416955744767
       217          224    3.657332189276863    0.020933391910799    1.000000000000000    0.000263092829816
       218          225    3.657330995634291    0.088127241184106    1.000000000000000    0.000206375189317
       219          226    3.657330351526148    0.024645060908109    1.000000000000000    0.000269832868927
       220          227    3.657327605961692    0.123616143017754    1.000000000000000    0.000395619185432
       221          229    3.657326873344727    0.037045568539009    0.298702126772168    0.000810850631214
       222          230    3.657325297832833    0.041062143921146    1.000000000000000    0.000571322146472
       223          231    3.657323037685092    0.069842392029339    1.000000000000000    0.000280282399265
       224          232    3.657321749592387    0.046290867640280    1.000000000000000    0.000285107739663
       225          233    3.657320835444741    0.074712886813758    1.000000000000000    0.000788058940006
       226          234    3.657319886848652    0.039369288649051    1.000000000000000    0.000246715583956
       227          235    3.657319566555831    0.010409770986716    1.000000000000000    0.000189372655559
       228          236    3.657318908378735    0.021986520397550    1.000000000000000    0.000201077710885
       229          237    3.657318087539059    0.028048731532565    1.000000000000000    0.000241117620100
       230          238    3.657317164550693    0.065840241088697    1.000000000000000    0.000471234844774
       231          239    3.657315871981509    0.057003220204929    1.000000000000000    0.000334840738720
       232          240    3.657314899570796    0.022829730730130    1.000000000000000    0.000285221560183
       233          241    3.657313695164754    0.062026057079971    1.000000000000000    0.000396646891761
       234          242    3.657312962913052    0.031487473760945    1.000000000000000    0.000507211235674
       235          243    3.657312308888017    0.015076153008297    1.000000000000000    0.000381883129277
       236          244    3.657311212338593    0.045861245631998    1.000000000000000    0.000192993856998
       237          245    3.657310750580056    0.021323074863546    1.000000000000000    0.000224943090582
       238          246    3.657309602673762    0.056738490967449    1.000000000000000    0.000277197981216
       239          247    3.657308264637894    0.055876560837163    1.000000000000000    0.000244968508304
       240          248    3.657307875335774    0.133541796540018    1.000000000000000    0.000621071530700
       241          249    3.657305437310877    0.067831835442782    1.000000000000000    0.000423274440914
       242          250    3.657304322694038    0.036796638060358    1.000000000000000    0.000231397605551
       243          251    3.657303080428170    0.026406837580675    1.000000000000000    0.000193269168220
       244          252    3.657301578590896    0.139853156167606    1.000000000000000    0.000308787312651
       245          253    3.657300103883926    0.058821777857578    1.000000000000000    0.000245623844926
       246          254    3.657298652414732    0.118242886680126    1.000000000000000    0.000497461197847
       247          255    3.657297575907316    0.062320209745078    1.000000000000000    0.000368535755534
       248          256    3.657296682824238    0.019586764709127    1.000000000000000    0.000299850961411
       249          257    3.657294280543419    0.072996699683226    1.000000000000000    0.000314206965824
       250          259    3.657293449895374    0.056487140739186    0.237046290700263    0.000357608829892
       251          260    3.657292272096845    0.053650636458095    1.000000000000000    0.000259927966199
       252          261    3.657290212034923    0.116480480169072    1.000000000000000    0.000209928030646
       253          262    3.657288543180505    0.113069555068959    1.000000000000000    0.000347331078969
       254          263    3.657286652890089    0.098011935366851    1.000000000000000    0.000320383500102
       255          264    3.657284702254627    0.121468035479736    1.000000000000000    0.000389936550251
       256          265    3.657283135694192    0.074525224120467    1.000000000000000    0.000445425583868
       257          266    3.657281898074569    0.029334015989495    1.000000000000000    0.000221103070073
       258          267    3.657281059411001    0.020735907029758    1.000000000000000    0.000222810592820
       259          268    3.657279961205267    0.039944896770748    1.000000000000000    0.000246106946274
       260          269    3.657278009123658    0.117783400038017    1.000000000000000    0.000333385851104
       261          270    3.657276722103249    0.100595013519630    1.000000000000000    0.000266958887217
       262          271    3.657275958047984    0.034112251792564    1.000000000000000    0.000176296530200
       263          272    3.657275341473101    0.031068749036654    1.000000000000000    0.000204664528639
       264          273    3.657274820283206    0.014665850524075    1.000000000000000    0.000173235088787
       265          274    3.657274064647422    0.020550688476304    1.000000000000000    0.000215301421493
       266          275    3.657273112626070    0.040993511989034    1.000000000000000    0.000244022207501
       267          276    3.657271541465523    0.064731637202564    1.000000000000000    0.000221813967884
       268          278    3.657270866953618    0.056449213243425    0.396242860354375    0.000318528285721
       269          279    3.657269797797346    0.068357777074882    1.000000000000000    0.000201310020917
       270          280    3.657268935810822    0.033334718972775    1.000000000000000    0.000197880556303
       271          281    3.657268018035603    0.064389375773645    1.000000000000000    0.000220690947486
       272          282    3.657267342684880    0.040741681478211    1.000000000000000    0.000211665701731
       273          283    3.657266866342123    0.032173057336773    1.000000000000000    0.000159079777415
       274          284    3.657266495333571    0.028651210662517    1.000000000000000    0.000124619927917
       275          285    3.657266174559957    0.021112790073871    1.000000000000000    0.000175479872464
       276          286    3.657265753771016    0.028070763516526    1.000000000000000    0.000214526411611
       277          287    3.657265371289992    0.025302457045692    1.000000000000000    0.000170314441999
       278          288    3.657264708289719    0.037133918681783    1.000000000000000    0.000129404235950
       279          289    3.657263959284236    0.054740174434211    1.000000000000000    0.000151151213718
       280          290    3.657263081798937    0.053604778757434    1.000000000000000    0.000154976751464
       281          291    3.657262314792079    0.088140756390208    1.000000000000000    0.000256445782406
       282          292    3.657261617831122    0.028368423022021    1.000000000000000    0.000163064683795
       283          293    3.657261140669473    0.022839738889598    1.000000000000000    0.000151199038552
       284          294    3.657260637135223    0.021029632717517    1.000000000000000    0.000204436646939
       285          295    3.657259956625164    0.068446113800256    1.000000000000000    0.000184718590801
       286          296    3.657259363169488    0.034383611458656    1.000000000000000    0.000135130032785
       287          297    3.657258528087791    0.072381825877251    1.000000000000000    0.000120584272316
       288          298    3.657257835745062    0.053213970343995    1.000000000000000    0.000212378158653
       289          299    3.657257078667013    0.071955044898906    1.000000000000000    0.000132309101009
       290          300    3.657256518730188    0.029554739478221    1.000000000000000    0.000115825511741
       291          301    3.657255672410260    0.042169180141131    1.000000000000000    0.000131853158370
       292          302    3.657255454227237    0.090736654999543    1.000000000000000    0.000314133946604
       293          303    3.657254698847229    0.017025956357873    1.000000000000000    0.000102647423189
       294          304    3.657254401106322    0.018162494704649    1.000000000000000    0.000086139101303
       295          305    3.657254041690745    0.036582446119644    1.000000000000000    0.000121047495896
       296          306    3.657253525110505    0.043028914933628    1.000000000000000    0.000125574524579
       297          307    3.657252903191759    0.094535566872640    1.000000000000000    0.000304516888458
       298          308    3.657252170905968    0.062795399232423    1.000000000000000    0.000102802901770
       299          309    3.657251852089047    0.025895036358240    1.000000000000000    0.000073912126551
       300          310    3.657251452959306    0.021695812022613    1.000000000000000    0.000096051941603
       301          311    3.657250954267346    0.033216491806089    1.000000000000000    0.000128412266953
       302          312    3.657250271607573    0.068455360448624    1.000000000000000    0.000127679286391
       303          313    3.657249599986525    0.084850789073869    1.000000000000000    0.000122490068000
       304          314    3.657249058822468    0.058330635089064    1.000000000000000    0.000109555462463
       305          315    3.657248492679066    0.045648644759421    1.000000000000000    0.000136002580387
       306          316    3.657248115456795    0.106378094827169    1.000000000000000    0.000348310287550
       307          317    3.657247303729208    0.019839852324951    1.000000000000000    0.000109333955699
       308          318    3.657246840811921    0.019737793680819    1.000000000000000    0.000117474954868
       309          319    3.657246413074599    0.035805112972736    1.000000000000000    0.000139949096449
       310          320    3.657245949620748    0.099569159825882    1.000000000000000    0.000540910934624
       311          321    3.657245103939950    0.058798601469809    1.000000000000000    0.000158221327986
       312          322    3.657244710924431    0.034625013194387    1.000000000000000    0.000099075664476
       313          323    3.657244424636444    0.036272466960969    1.000000000000000    0.000111118927734
       314          324    3.657243931894523    0.044227648291357    1.000000000000000    0.000138540756234
       315          325    3.657243326993349    0.148270392101167    1.000000000000000    0.000325894842758
       316          326    3.657242602202178    0.032033003764582    1.000000000000000    0.000204514445935
       317          327    3.657242355446018    0.021530517427744    1.000000000000000    0.000154429955711
       318          329    3.657242228100509    0.016930124620808    0.404457420558154    0.000234594428436
       319          330    3.657242049993269    0.018717612236263    1.000000000000000    0.000125334796111
       320          331    3.657241864537929    0.023641466628950    1.000000000000000    0.000125082474263
       321          332    3.657241520323223    0.053878111795251    1.000000000000000    0.000166843584578
       322          333    3.657241145846623    0.043296111719388    1.000000000000000    0.000199884828539
       323          335    3.657240831939463    0.067177003260879    0.485843057837235    0.000268976181767
       324          336    3.657240414199642    0.034637943098655    1.000000000000000    0.000127263380015
       325          337    3.657240079112530    0.023549116229609    1.000000000000000    0.000163622486684
       326          338    3.657239688973181    0.032261354624133    1.000000000000000    0.000166813992811
       327          340    3.657239555472297    0.024504537806130    0.255338341784417    0.000366799346616
       328          341    3.657239153198570    0.035464123736615    1.000000000000000    0.000210047470761
       329          342    3.657238759548363    0.046786035463296    1.000000000000000    0.000141557403330
       330          343    3.657238214169265    0.065780741901790    1.000000000000000    0.000142851752635
       331          344    3.657237562679385    0.071998968368914    1.000000000000000    0.000164679680795
       332          345    3.657237263784963    0.209256212493930    1.000000000000000    0.000657592198470
       333          346    3.657235874683989    0.047715695723055    1.000000000000000    0.000188232795937
       334          347    3.657235350314555    0.025636460284392    1.000000000000000    0.000138301000061
       335          348    3.657234681796798    0.069480760258914    1.000000000000000    0.000143905864569
       336          349    3.657233765622839    0.078765744968204    1.000000000000000    0.000177744673044
       337          351    3.657233009210485    0.157234178100253    0.355435647730987    0.000555833275237
       338          352    3.657231157029023    0.218309930203875    1.000000000000000    0.000252895119964
       339          353    3.657229772427560    0.236319988024768    1.000000000000000    0.000252567225403
       340          354    3.657227571911789    0.344358398428505    1.000000000000000    0.000295642152138
       341          355    3.657224849204823    0.838547968162931    1.000000000000000    0.000664684951391
       342          356    3.657219219315109    0.362915282816680    1.000000000000000    0.000632243117793
       343          357    3.657211339898420    0.102617566436775    1.000000000000000    0.000522572250715
       344          359    3.657201679249089    0.320987909829565    0.390448242922916    0.000434873628429
       345          361    3.657196897939453    0.170424332588121    0.209800797243543    0.001030897659490
       346          362    3.657192868294325    0.321399018744568    1.000000000000000    0.000822754279554
       347          364    3.657185529964232    0.248311936056616    0.459330531413875    0.000622173812619
       348          365    3.657177154752766    0.247609023920388    1.000000000000000    0.001160298549123
       349          366    3.657171304254377    0.193395819815675    1.000000000000000    0.001644624274999
       350          367    3.657161920433743    0.110013257123931    1.000000000000000    0.000652469738870
       351          368    3.657156364621076    0.149229801659132    1.000000000000000    0.000772922513553
       352          369    3.657149739774512    0.151915625614047    1.000000000000000    0.001056362725732
       353          370    3.657139144154096    0.154365451347378    1.000000000000000    0.000664706118035
       354          371    3.657128763487194    0.171861198760467    1.000000000000000    0.000606798833174
       355          372    3.657119009851084    0.174329400190667    1.000000000000000    0.000947492306898
       356          373    3.657108980947776    0.124775738244357    1.000000000000000    0.000604979044939
       357          374    3.657100463444985    0.167958963557239    1.000000000000000    0.001010886498108
       358          375    3.657092644523988    0.119422856890290    1.000000000000000    0.000851584334810
       359          376    3.657085938314915    0.050078074723692    1.000000000000000    0.000725347750652
       360          377    3.657073997452418    0.133787277767871    1.000000000000000    0.000536175000294
       361          378    3.657064716142542    0.185070166037340    1.000000000000000    0.000695161786691
       362          379    3.657056164695458    0.208013506723374    1.000000000000000    0.000869169354849
       363          380    3.657049685454331    0.116951539240630    1.000000000000000    0.000606522623590
       364          381    3.657044104117433    0.111916928819588    1.000000000000000    0.000788158431358
       365          382    3.657039268661240    0.100170914648453    1.000000000000000    0.000953855638792
       366          383    3.657033451580740    0.050514046086192    1.000000000000000    0.000654967961364
       367          384    3.657023844537501    0.147191441299056    1.000000000000000    0.000461183269665
       368          385    3.657019841358716    0.062936562841052    1.000000000000000    0.000384215225501
       369          386    3.657010572475015    0.168482714341596    1.000000000000000    0.000382310063953
       370          387    3.657004044106286    0.114681408467937    1.000000000000000    0.000476926041157
       371          388    3.657002332845731    0.177526158458156    1.000000000000000    0.001131391748642
       372          389    3.656995268528264    0.077994175852004    1.000000000000000    0.000444859803193
       373          390    3.656992299817581    0.042361565721344    1.000000000000000    0.000344152859804
       374          391    3.656987843883992    0.084408953279882    1.000000000000000    0.000516251914039
       375          392    3.656986366072265    0.150365647781525    1.000000000000000    0.001113422229999
       376          393    3.656982295391861    0.068586342802145    1.000000000000000    0.000450192598450
       377          394    3.656980138043132    0.077580097593309    1.000000000000000    0.000298994177678
       378          395    3.656978035979152    0.086628368148914    1.000000000000000    0.000409591884889
       379          396    3.656975085391119    0.104118661498367    1.000000000000000    0.000503936792828
       380          397    3.656973882264964    0.173174887493818    1.000000000000000    0.001039536716038
       381          398    3.656967902724968    0.083483215911599    1.000000000000000    0.000331836809221
       382          399    3.656965849447882    0.057924176516024    1.000000000000000    0.000240415105826
       383          400    3.656963438058930    0.076588712779459    1.000000000000000    0.000340269194684
       384          401    3.656961187498931    0.053828050287813    1.000000000000000    0.000354717835412
       385          402    3.656959456670491    0.142852840019894    1.000000000000000    0.000638263115834
       386          403    3.656957238024685    0.072984008844629    1.000000000000000    0.000347108539251
       387          404    3.656956058417657    0.044560151130020    1.000000000000000    0.000325866064724
       388          405    3.656954428226998    0.053457279684687    1.000000000000000    0.000288762809840
       389          406    3.656951192620685    0.081661997294599    1.000000000000000    0.000428846442455
       390          407    3.656948548224938    0.095214986975221    1.000000000000000    0.000457709954092
       391          408    3.656946322086622    0.047493416032641    1.000000000000000    0.000305026322864
       392          409    3.656943934565987    0.057023850219436    1.000000000000000    0.000277112427188
       393          410    3.656941958694016    0.053981452163309    1.000000000000000    0.000341928299053
       394          411    3.656939571809310    0.073078385410619    1.000000000000000    0.000276780264576
       395          412    3.656937454481462    0.066948267980887    1.000000000000000    0.000245005841167
       396          413    3.656936175025012    0.070599552659209    1.000000000000000    0.000361398296145
       397          414    3.656934866177352    0.045712487624029    1.000000000000000    0.000220915278377
       398          415    3.656933857000606    0.029817526621663    1.000000000000000    0.000191959300891
       399          416    3.656932201494577    0.044867626259607    1.000000000000000    0.000299244852822
       400          417    3.656931091215334    0.041251706363967    1.000000000000000    0.000268041964618
       401          418    3.656930088068501    0.065840405851871    1.000000000000000    0.000189147274223
       402          419    3.656929165714267    0.038419345044104    1.000000000000000    0.000175382621623
       403          420    3.656928052203284    0.039445618944680    1.000000000000000    0.000339616276680
       404          421    3.656927186821041    0.032750268635613    1.000000000000000    0.000338135595538
       405          422    3.656925413148170    0.062859567997230    1.000000000000000    0.000232820773540
       406          423    3.656924364471760    0.079692247760989    1.000000000000000    0.000272601989659
       407          424    3.656923382742917    0.026124787384946    1.000000000000000    0.000249977165144
       408          425    3.656922777346115    0.029146125286481    1.000000000000000    0.000201480223209
       409          426    3.656922185535336    0.037294651688338    1.000000000000000    0.000332709418559
       410          427    3.656921394794840    0.041494641835504    1.000000000000000    0.000162546947503
       411          428    3.656920783592990    0.030644138757906    1.000000000000000    0.000203628708190
       412          429    3.656920142198000    0.049126284698009    1.000000000000000    0.000240248053414
       413          431    3.656919969339059    0.018653022234261    0.192564054901212    0.000334375082434
       414          432    3.656919558948371    0.022925406134457    1.000000000000000    0.000226602194504
       415          433    3.656919010545031    0.030556493253039    1.000000000000000    0.000129485777849
       416          434    3.656918663363213    0.018039075242274    1.000000000000000    0.000139429741562
       417          435    3.656918158074524    0.022574849273478    1.000000000000000    0.000154981005862
       418          437    3.656917912541163    0.021791076294136    0.343493567678664    0.000224123719980
       419          438    3.656917448558936    0.026764943944255    1.000000000000000    0.000158964115190
       420          440    3.656917303233567    0.013449083724636    0.429641437858762    0.000187674081725
       421          441    3.656917126595608    0.012125035576923    1.000000000000000    0.000101927301345
       422          442    3.656917000052972    0.008450758983700    1.000000000000000    0.000102438828696
       423          443    3.656916808486124    0.011209631710882    1.000000000000000    0.000110262067346
       424          444    3.656916385392032    0.023300993312329    1.000000000000000    0.000123417681607
       425          446    3.656916265286010    0.012642162026794    0.287566271065507    0.000263271495009
       426          447    3.656915919428848    0.023570081948456    1.000000000000000    0.000126711634693
       427          448    3.656915727012724    0.012890852403119    1.000000000000000    0.000094541492450
       428          449    3.656915493245879    0.014948140538859    1.000000000000000    0.000097001223159
       429          451    3.656915408645194    0.010641574955279    0.381541000634582    0.000230404045198
       430          452    3.656915198676377    0.013197944121563    1.000000000000000    0.000114521440176
       431          453    3.656915013060340    0.012809252963999    1.000000000000000    0.000091436286804
       432          454    3.656914804143920    0.016167246773489    1.000000000000000    0.000111238109424
       433          455    3.656914527416811    0.019844179815164    1.000000000000000    0.000099304673586
       434          457    3.656914406514713    0.019577870863523    0.341485662002503    0.000190793275716
       435          458    3.656914138182529    0.022313518340807    1.000000000000000    0.000091504852554
       436          459    3.656913938962004    0.017860194196070    1.000000000000000    0.000093103433451
       437          460    3.656913623898780    0.029538629717659    1.000000000000000    0.000118668685884
       438          462    3.656913477786419    0.023736883591385    0.443316229513813    0.000238742579630
       439          463    3.656913212382933    0.027796289246569    1.000000000000000    0.000128210254876
       440          464    3.656912991947998    0.018997205714438    1.000000000000000    0.000083177115854
       441          465    3.656912790910067    0.022271998809657    1.000000000000000    0.000110178373528
       442          466    3.656912570490218    0.024088754871424    1.000000000000000    0.000112272208147
       443          467    3.656912289054554    0.028409563581015    1.000000000000000    0.000094705705870
       444          468    3.656911934685299    0.030493747231628    1.000000000000000    0.000117692976460
       445          469    3.656911599357800    0.041663805111366    1.000000000000000    0.000092049089833
       446          470    3.656911389645952    0.027155191906880    1.000000000000000    0.000103923455759
       447          471    3.656911284459333    0.047602994534062    1.000000000000000    0.000226389401025
       448          472    3.656911109792186    0.007823996351952    1.000000000000000    0.000080668100385
       449          473    3.656910983070096    0.008521059960360    1.000000000000000    0.000078439910124
       450          474    3.656910826855799    0.017933901532050    1.000000000000000    0.000102258876162
       451          475    3.656910611093577    0.024341049912541    1.000000000000000    0.000125379336403
       452          477    3.656910495616464    0.019528613227336    0.190314951263839    0.000161982040487
       453          478    3.656910184189426    0.036003337181074    1.000000000000000    0.000088904376817
       454          479    3.656909950995018    0.023543403383831    1.000000000000000    0.000089831804281
       455          480    3.656909631438649    0.034948035182095    1.000000000000000    0.000117526428036
       456          481    3.656909475788714    0.051346744935818    1.000000000000000    0.000181020081890
       457          482    3.656909099613155    0.019570493529573    1.000000000000000    0.000083552042871
       458          483    3.656908823217695    0.014812296297697    1.000000000000000    0.000085708766193
       459          484    3.656908501184833    0.034496844976667    1.000000000000000    0.000099713533069
       460          486    3.656908393822291    0.021705898828577    0.267232433657435    0.000165630879648
       461          487    3.656908212309410    0.033411463707829    1.000000000000000    0.000093228407674
       462          488    3.656908047588441    0.031621019072782    1.000000000000000    0.000070820500786
       463          489    3.656907844108744    0.033290926327059    1.000000000000000    0.000105702677854
       464          490    3.656907520659729    0.041847625390072    1.000000000000000    0.000140082806766
       465          491    3.656907054386277    0.055508571709014    1.000000000000000    0.000187436484947
       466          493    3.656906866294078    0.034591054970377    0.367658301992451    0.000192743733100
       467          494    3.656906621632697    0.017314678123326    1.000000000000000    0.000080681294032
       468          495    3.656906495624510    0.012324989339835    1.000000000000000    0.000065405093438
       469          496    3.656906367342603    0.009075551330748    1.000000000000000    0.000088030767472
       470          497    3.656906145273974    0.024447129960193    1.000000000000000    0.000098757489671
       471          499    3.656906033306229    0.028286708318996    0.352725731410048    0.000148991448100
       472          500    3.656905860668041    0.025800911091689    1.000000000000000    0.000079352718868
       473          501    3.656905716565275    0.026738849526710    1.000000000000000    0.000069509255658
       474          502    3.656905635183010    0.013806121237920    1.000000000000000    0.000087334630845
       475          503    3.656905491414332    0.020021344813195    1.000000000000000    0.000125262443122
       476          504    3.656905349106204    0.032956600871798    1.000000000000000    0.000101925008683
       477          505    3.656905196927860    0.007711607119841    1.000000000000000    0.000065074958202
       478          506    3.656905031051701    0.014608832408586    1.000000000000000    0.000087330423431
       479          507    3.656905003237695    0.024191257336851    1.000000000000000    0.000227248566569
       480          508    3.656904885066054    0.008767390996484    1.000000000000000    0.000100692428264
       481          509    3.656904797666696    0.018380700189547    1.000000000000000    0.000068015610160
       482          510    3.656904729741298    0.022063342414169    1.000000000000000    0.000087305944000
       483          511    3.656904648511583    0.018986750233295    1.000000000000000    0.000084606715801
       484          512    3.656904518924355    0.030714828416586    1.000000000000000    0.000079509880263
       485          514    3.656904438547410    0.019592415547160    0.338660489311908    0.000122085250894
       486          515    3.656904319030688    0.009591098457708    1.000000000000000    0.000092564205149
       487          516    3.656904141701997    0.023047769242714    1.000000000000000    0.000066598471938
       488          518    3.656904083410236    0.011148685364647    0.375770592367600    0.000102882266684
       489          519    3.656904004227716    0.010578028446167    1.000000000000000    0.000079952087294
       490          520    3.656903849366417    0.031599220330725    1.000000000000000    0.000071016684129
       491          521    3.656903749385242    0.025199379685886    1.000000000000000    0.000067507501758
       492          522    3.656903672182448    0.057127411707419    1.000000000000000    0.000198838293001
       493          523    3.656903477784581    0.014062064665413    1.000000000000000    0.000065584717885
       494          524    3.656903386664340    0.006441369961938    1.000000000000000    0.000059780879208
       495          525    3.656903268791455    0.013957955553605    1.000000000000000    0.000082120181268
       496          526    3.656903123616130    0.023280818807074    1.000000000000000    0.000101792883756
       497          527    3.656902943556196    0.038396570858913    1.000000000000000    0.000068884785774
       498          528    3.656902756409335    0.037550199023921    1.000000000000000    0.000082028615886
       499          529    3.656902562358492    0.039288987032290    1.000000000000000    0.000079805958667
       500          530    3.656902453693212    0.035555091126902    1.000000000000000    0.000096971502558
>>> Maximum iteration count reached.
After: gradient norm = 9.697150255823326E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0111,0.0111}

Count Table 2:
---------------
h:                 {0.6214,-0.6214}

Count Table 3:
---------------
h:                 {0.6336,-0.6336}

Count Table 4:
---------------
h:                 {0.8389,-0.8389}

Count Table 5:
---------------
h:                 {0.9827,-0.9827}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Activity(exp=5):   {0.0000,0.0000}


==================================
== Starts fiting Binding mode 3 ==
==================================
> Optimizing h (component3-0-h).
>>  Starting new optimization: component3-0-h. (2021-05-21 19:29:27.613).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[0,1]},{"h":[2,3]},{"h":[4,5]},{"h":[6,7]},{"h":[8,9]},{"h":[10,11]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.387896173450695
gradient      = {0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.3677,0.3677,-0.3021,0.3021}
gradient norm = 0.6730203322489482
Starting Function Value: 4.387896173450695
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            2    3.862519438394367    1.000000000000000    1.485839211808690    0.355104945856295
         2            3    3.720507804127612    1.125587683451966    1.000000000000000    0.109056274403633
         3            4    3.705908591649905    0.263534786991224    1.000000000000000    0.001070390549083
         4            5    3.705907258636385    0.002565630193738    1.000000000000000    0.000028941594190
         5            6    3.705907225370345    0.000070371353583    1.000000000000000    0.000000857596166
Gradient   = {-1.0988e-09,1.0988e-09,3.4646e-08,-3.4646e-08,6.5205e-09,-6.5205e-09,5.1202e-11,-5.1202e-11,-2.0527e-07,2.0527e-07,-5.6952e-07,5.6952e-07}
pCurr      = {2.8882e-09,-2.8882e-09,-8.9850e-08,8.9850e-08,-1.7092e-08,1.7092e-08,-1.1016e-10,1.1016e-10,4.8481e-07,-4.8481e-07,1.4584e-06,-1.4584e-06}
grad*pCur  = -1.866640902551569E-12
parameters = {9.6665e-02,-9.6665e-02,-1.1076e-02,1.1076e-02,6.2140e-01,-6.2140e-01,6.3351e-01,-6.3351e-01,1.8690e+00,-1.8690e+00,1.8140e+00,-1.8140e+00}
|grad|/|x| = 2.2024857276223578E-7
>>>> Exception caugth. Parameters reverted.
> Parameter: {9.6665e-02,-9.6665e-02,-1.1076e-02,1.1076e-02,6.2140e-01,-6.2140e-01,6.3351e-01,-6.3351e-01,1.8690e+00,-1.8690e+00,1.8140e+00,-1.8140e+00}
> Gradient:  {-1.0988e-09,1.0988e-09,3.4646e-08,-3.4646e-08,6.5205e-09,-6.5205e-09,5.1202e-11,-5.1202e-11,-2.0527e-07,2.0527e-07,-5.6952e-07,5.6952e-07}
>>>> Re-trying (1/3).
Gradient   = {-1.0987e-09,1.0987e-09,3.4642e-08,-3.4642e-08,6.9063e-09,-6.9063e-09,5.1195e-11,-5.1195e-11,-2.0503e-07,2.0503e-07,-5.6946e-07,5.6946e-07}
pCurr      = {1.0988e-09,-1.0988e-09,-3.4646e-08,3.4646e-08,-6.5205e-09,6.5205e-09,-5.1202e-11,5.1202e-11,2.0527e-07,-2.0527e-07,5.6952e-07,-5.6952e-07}
grad*pCur  = -7.353045200827682E-13
parameters = {9.6665e-02,-9.6665e-02,-1.1076e-02,1.1076e-02,6.2140e-01,-6.2140e-01,6.3351e-01,-6.3351e-01,1.8690e+00,-1.8690e+00,1.8140e+00,-1.8140e+00}
|grad|/|x| = 2.2019875481470734E-7
>>>> Exception caugth. Parameters reverted.
> Parameter: {9.6665e-02,-9.6665e-02,-1.1076e-02,1.1076e-02,6.2140e-01,-6.2140e-01,6.3351e-01,-6.3351e-01,1.8690e+00,-1.8690e+00,1.8140e+00,-1.8140e+00}
> Gradient:  {-1.0987e-09,1.0987e-09,3.4642e-08,-3.4642e-08,6.9063e-09,-6.9063e-09,5.1195e-11,-5.1195e-11,-2.0503e-07,2.0503e-07,-5.6946e-07,5.6946e-07}
>>>> Re-trying (2/3).
>>>> Exception caugth. Parameters reverted.
> Parameter: {9.6665e-02,-9.6665e-02,-1.1076e-02,1.1076e-02,6.2140e-01,-6.2140e-01,6.3351e-01,-6.3351e-01,1.8690e+00,-1.8690e+00,1.8140e+00,-1.8140e+00}
> Gradient:  {-1.0988e-09,1.0988e-09,3.4646e-08,-3.4646e-08,6.5205e-09,-6.5205e-09,5.1202e-11,-5.1202e-11,-2.0527e-07,2.0527e-07,-5.6952e-07,5.6952e-07}
>>>> Re-trying (3/3).
After: gradient norm = 8.575961661089979E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0111,0.0111}

Count Table 2:
---------------
h:                 {0.6214,-0.6214}

Count Table 3:
---------------
h:                 {0.6335,-0.6335}

Count Table 4:
---------------
h:                 {1.8690,-1.8690}

Count Table 5:
---------------
h:                 {1.8140,-1.8140}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {4.3723,4.3510}
Activity(exp=1):   {4.3723,4.1885}
Activity(exp=2):   {4.3799,5.4065}
Activity(exp=3):   {4.3799,5.2368}
Activity(exp=4):   {4.3809,5.4934}
Activity(exp=5):   {4.3809,5.6125}

> Initial optimization (component3-1-f1).
>>  Starting new optimization: component3-1-f1. (2021-05-21 19:31:35.319).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[84,85]},{"h":[86,87]},{"h":[88,89]},{"h":[90,91]},{"h":[92,93]},{"h":[94,95]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71],"activity":[[72,73],[74,75],[76,77],[78,79],[80,81],[82,83]]}]}

Value and gradient before optimization:
=======================================
value         = 3.705907207805773
gradient      = {0.0036,0.0060,0.0128,0.0074,-0.0006,-0.0008,0.0024,0.0071,0.0112,0.0090,-0.0007,-0.0006,0.0051,0.0053,0.0080,0.0121,-0.0013,-0.0007,0.0054,0.0027,0.0064,0.0165,-0.0013,-0.0013,0.0011,0.0049,0.0228,0.0022,-0.0013,-0.0013,0.0034,0.0172,0.0066,0.0043,-0.0018,-0.0013,0.0182,0.0057,0.0014,0.0059,-0.0011,-0.0018,0.0030,0.0066,0.0076,0.0140,-0.0016,-0.0011,0.0048,0.0213,0.0052,0.0015,-0.0028,-0.0016,0.0176,0.0084,0.0028,0.0032,-0.0008,-0.0028,0.0094,0.0120,0.0043,0.0038,-0.0004,-0.0008,0.0097,0.0103,0.0060,0.0035,-0.0007,-0.0004,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0103,0.0000,0.0181,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 0.06833751582651189
Starting Function Value: 3.705907207805773
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.703299890773788    0.078205382570083    1.144398967744493    0.051276583992524
         2            4    3.701439935991615    0.045693860287947    1.000000000000000    0.049317250206169
         3            6    3.671339544391934    1.091392069377750    0.365541179341703    0.059956810472026
         4            7    3.666685460184326    0.770820808432878    1.000000000000000    0.107622401625298
         5            8    3.661950992379996    0.245496896186260    1.000000000000000    0.039049749903585
         6            9    3.660038603984952    0.131410070810608    1.000000000000000    0.021591732593153
         7           10    3.657739326393140    0.363710892189390    1.000000000000000    0.018663280870468
         8           11    3.656888093414616    0.196331198942673    1.000000000000000    0.015107610157480
         9           12    3.656252794581722    0.170754821846036    1.000000000000000    0.005868448735681
        10           13    3.655925054017628    0.203407630732538    1.000000000000000    0.006158865036548
        11           14    3.655590896307565    0.228529435046260    1.000000000000000    0.004443909566658
        12           15    3.655383928655825    0.352323797286312    1.000000000000000    0.006353061722355
        13           16    3.655160716456033    0.219696766169396    1.000000000000000    0.002043727850532
        14           17    3.654863006476994    0.570370236977124    1.000000000000000    0.002304661166678
        15           19    3.654842012491012    0.061337186439216    0.037850757080291    0.004171072902050
        16           20    3.654599950572883    0.686054295477268    1.000000000000000    0.002739533496869
        17           21    3.654584819149659    0.223666255368606    1.000000000000000    0.000903700816768
        18           22    3.654577041292856    0.045724162175407    1.000000000000000    0.002293743639977
        19           23    3.654543703326781    0.104630135409050    1.000000000000000    0.003156150986764
        20           24    3.654377043950171    0.811455319065227    1.000000000000000    0.003623892409505
        21           25    3.654335465078462    0.217120676191765    1.000000000000000    0.003006123863470
        22           26    3.654300808932797    0.117750855166407    1.000000000000000    0.001824878573138
        23           27    3.654273629682471    0.055077751273294    1.000000000000000    0.002974752912590
        24           28    3.654215750450619    0.178013059035595    1.000000000000000    0.005412046191838
        25           29    3.654175927957044    0.099026774078706    1.000000000000000    0.006314250607464
        26           30    3.654083320626114    0.247556447936192    1.000000000000000    0.007095831665751
        27           31    3.653994427251976    0.265009732575169    1.000000000000000    0.005938622489083
        28           33    3.653951492821403    0.250560404577457    0.494572059252010    0.004876794983973
        29           34    3.653913792003471    0.098835861666803    1.000000000000000    0.001235626735590
        30           35    3.653910069992296    0.083233497813583    1.000000000000000    0.000796585491459
        31           36    3.653908512581046    0.004544781688142    1.000000000000000    0.000663173087059
        32           37    3.653905267631016    0.010634839591594    1.000000000000000    0.000953385726733
        33           38    3.653897134926571    0.034596817720134    1.000000000000000    0.001944700778804
        34           39    3.653875606386610    0.083916440962719    1.000000000000000    0.003417871864247
        35           40    3.653830038316162    0.201141682979033    1.000000000000000    0.005128213026685
        36           41    3.653767436553180    0.345888245210130    1.000000000000000    0.005536105126976
        37           42    3.653722599834513    0.261533862327877    1.000000000000000    0.003159278556258
        38           43    3.653706729044801    0.153096060591087    1.000000000000000    0.001868967186526
        39           44    3.653701376597330    0.032040640845891    1.000000000000000    0.000765593061344
        40           45    3.653700006896823    0.017392069275589    1.000000000000000    0.000619979529328
        41           46    3.653697040350579    0.066739347980817    1.000000000000000    0.000822196375346
        42           47    3.653693440111708    0.026878991805850    1.000000000000000    0.001037803711532
        43           48    3.653677628288397    0.109566204827615    1.000000000000000    0.002062637593635
        44           49    3.653649911464917    0.172939249000057    1.000000000000000    0.002751077258843
        45           50    3.653598812972483    0.335449457136066    1.000000000000000    0.003619316115413
        46           51    3.653544824302773    0.370528335989095    1.000000000000000    0.002416926514199
        47           52    3.653516935885756    0.200232037077953    1.000000000000000    0.000559661944508
        48           53    3.653513716522039    0.175993452332161    1.000000000000000    0.000606325167858
        49           54    3.653507087172272    0.050380369221711    1.000000000000000    0.000479877622540
        50           55    3.653484269255916    0.203838303611874    1.000000000000000    0.001684964552480
        51           56    3.653439565055300    0.430992805139297    1.000000000000000    0.002510758893084
        52           57    3.653405443935479    0.412238360753777    1.000000000000000    0.001897559703016
        53           58    3.653382400900546    0.268041686375308    1.000000000000000    0.002027953804399
        54           59    3.653363908519407    0.207561766310968    1.000000000000000    0.000443288433325
        55           60    3.653355204147282    0.099326989389996    1.000000000000000    0.001305211314728
        56           61    3.653347712987487    0.063198435810524    1.000000000000000    0.001930553491548
        57           62    3.653329840498839    0.169983155059708    1.000000000000000    0.002810923460571
        58           63    3.653307204327611    0.182720627650174    1.000000000000000    0.003142360196247
        59           64    3.653271509964441    0.246718874184519    1.000000000000000    0.002247089517321
        60           65    3.653250192406805    0.154294800818355    1.000000000000000    0.000652015686223
        61           66    3.653245728814386    0.077949190032896    1.000000000000000    0.000442697468228
        62           67    3.653244611834575    0.055882656393327    1.000000000000000    0.000415585492229
        63           68    3.653227499906781    0.119710130872356    1.000000000000000    0.000556905086716
        64           69    3.653202611275569    0.558209182865705    1.000000000000000    0.001239179473005
        65           70    3.653185815572717    0.175450234933900    1.000000000000000    0.000589318361353
        66           71    3.653184377744164    0.034788312959212    1.000000000000000    0.000213841934976
        67           72    3.653183781538993    0.020792888225971    1.000000000000000    0.000209624254674
        68           73    3.653182618135729    0.025526539245315    1.000000000000000    0.000372203127501
        69           74    3.653178834215321    0.068995016568127    1.000000000000000    0.000809668098302
        70           75    3.653172067352300    0.111006469443092    1.000000000000000    0.001270693470747
        71           76    3.653161521483286    0.167755112284709    1.000000000000000    0.001444000959959
        72           77    3.653149590225892    0.165669964821593    1.000000000000000    0.000919722811182
        73           78    3.653141031866190    0.161085002744452    1.000000000000000    0.000208011753231
        74           79    3.653138530285472    0.084243310398720    1.000000000000000    0.000557887839368
        75           80    3.653135307308470    0.108663297590868    1.000000000000000    0.000868044266083
        76           81    3.653129906664020    0.169457065224625    1.000000000000000    0.001015850842982
        77           82    3.653123281403714    0.162833601738917    1.000000000000000    0.000700921155308
        78           83    3.653119541776691    0.059583413048204    1.000000000000000    0.000299649222700
        79           84    3.653118211722771    0.082466520717794    1.000000000000000    0.000149429884202
        80           85    3.653117712463759    0.028647103012049    1.000000000000000    0.000242759543274
        81           86    3.653117004195740    0.028182358094799    1.000000000000000    0.000395373393589
        82           87    3.653115465778334    0.030970611547787    1.000000000000000    0.000613693135734
        83           88    3.653112721400372    0.063588174235852    1.000000000000000    0.000793488638759
        84           89    3.653109171608556    0.120780947080343    1.000000000000000    0.000686808549037
        85           90    3.653105590817023    0.141713308827249    1.000000000000000    0.000326937201508
        86           91    3.653102708976040    0.178434185739180    1.000000000000000    0.000249837480778
        87           92    3.653101283278439    0.095391524417447    1.000000000000000    0.000502343882247
        88           93    3.653098931022947    0.137548953580747    1.000000000000000    0.000697680598502
        89           94    3.653095856343616    0.147667283883372    1.000000000000000    0.000697573039512
        90           95    3.653088364061471    0.286068393850880    1.000000000000000    0.000522312700408
        91           96    3.653080874432266    0.402153572650608    1.000000000000000    0.000329434931034
        92           97    3.653078607981071    0.058249793399811    1.000000000000000    0.000334691999399
        93           98    3.653076930329892    0.109979626375976    1.000000000000000    0.000327500295951
        94           99    3.653073919037119    0.185058999720359    1.000000000000000    0.000216808142969
        95          100    3.653069899579872    0.374201866916942    1.000000000000000    0.000206813112119
        96          101    3.653066467869385    0.374027403802500    1.000000000000000    0.000391818042884
        97          102    3.653063527966991    0.344235219326616    1.000000000000000    0.000488405322525
        98          103    3.653060658809049    0.192951944965945    1.000000000000000    0.000456062900532
        99          104    3.653054077084970    0.325532122135517    1.000000000000000    0.000277071291582
       100          105    3.653046350437249    0.367340040382873    1.000000000000000    0.000268519149701
       101          106    3.653043097188133    0.117238244034997    1.000000000000000    0.000397654374595
       102          107    3.653040311954507    0.147622857592899    1.000000000000000    0.000391619602914
       103          108    3.653036905050060    0.305989166535365    1.000000000000000    0.000280141308082
       104          109    3.653033465074215    0.502413572881576    1.000000000000000    0.000179568023188
       105          110    3.653031395261024    0.379006960950595    1.000000000000000    0.000371227941692
       106          111    3.653029214132466    0.333394327133853    1.000000000000000    0.000541427814599
       107          112    3.653026845335087    0.192065786654228    1.000000000000000    0.000546600147338
       108          113    3.653025075596772    0.245749961271438    1.000000000000000    0.000478052177973
       109          114    3.653017658274631    0.287802798621413    1.000000000000000    0.001470439138540
       110          116    3.653016061517626    0.070304275652061    0.284096915362798    0.001085874713355
       111          117    3.653013618824572    0.172907559221937    1.000000000000000    0.000191626149678
       112          118    3.653013457600018    0.026275185497570    1.000000000000000    0.000129661534991
       113          119    3.653013050620093    0.085489499019717    1.000000000000000    0.000103713562843
       114          120    3.653012262878718    0.164770893996882    1.000000000000000    0.000104513367721
       115          121    3.653010563328508    0.449911455881799    1.000000000000000    0.000188965083209
       116          122    3.653009414175918    0.272094282652491    1.000000000000000    0.000551964931678
       117          123    3.653007825395969    0.238418467123044    1.000000000000000    0.000254151542792
       118          124    3.653006647211030    0.123105250621127    1.000000000000000    0.000144484671146
       119          125    3.653005988396242    0.211676571624148    1.000000000000000    0.000101151646613
       120          126    3.653005600652366    0.153262550003610    1.000000000000000    0.000106079732781
       121          127    3.653004547052686    0.120186405113297    1.000000000000000    0.000210939919060
       122          128    3.653001562501353    0.255466902014920    1.000000000000000    0.000434447498502
       123          129    3.652997657681793    0.287118284136054    1.000000000000000    0.000675305357002
       124          130    3.652992703297808    0.427279698463162    1.000000000000000    0.000410357889571
       125          131    3.652987137827974    0.999212460032901    1.000000000000000    0.000519158391263
       126          132    3.652986613666201    0.460127568152535    1.000000000000000    0.000414753041915
       127          133    3.652986035177700    0.125420961607458    1.000000000000000    0.000148640421352
       128          134    3.652985818386984    0.021271223603251    1.000000000000000    0.000139969537359
       129          135    3.652985122784052    0.035900348851122    1.000000000000000    0.000228322497163
       130          136    3.652983402508549    0.058298609955491    1.000000000000000    0.000396126025641
       131          137    3.652979875891194    0.202336167819154    1.000000000000000    0.000828636906691
       132          138    3.652974670766407    0.331753922545893    1.000000000000000    0.000919019895082
       133          139    3.652965953314298    0.892196099479321    1.000000000000000    0.000755936187852
       134          141    3.652962784682857    0.192771302043173    0.389412991816654    0.000710144877280
       135          142    3.652960815895944    0.114635102603056    1.000000000000000    0.000161014456566
       136          143    3.652960477476560    0.047553846335457    1.000000000000000    0.000207925235923
       137          144    3.652959872364350    0.040652029408916    1.000000000000000    0.000281896000614
       138          145    3.652957515845698    0.157933810305809    1.000000000000000    0.000516434461840
       139          146    3.652952685036226    0.312944563148788    1.000000000000000    0.000787624548522
       140          147    3.652943237949862    0.706219196389632    1.000000000000000    0.001228689303809
       141          149    3.652937919964562    0.555946568697475    0.385188126495236    0.001508009877570
       142          150    3.652927448644345    0.685566517408407    1.000000000000000    0.000771972380617
       143          151    3.652919353367465    0.662633691944458    1.000000000000000    0.000540252397055
       144          152    3.652918660984871    0.219146148033782    1.000000000000000    0.000846742016917
       145          153    3.652917707340465    0.046602897832412    1.000000000000000    0.000202752853952
       146          154    3.652917499553726    0.045107535308704    1.000000000000000    0.000182336314511
       147          155    3.652916963672404    0.092384008187061    1.000000000000000    0.000291742864015
       148          156    3.652915875761788    0.125293976841639    1.000000000000000    0.000449301949427
       149          157    3.652913158461570    0.203128734909662    1.000000000000000    0.000685292005626
       150          158    3.652909908335488    0.378937692369181    1.000000000000000    0.001408394477905
       151          159    3.652903733902813    0.317407490954740    1.000000000000000    0.000764752787994
       152          160    3.652898124980730    0.618224966885353    1.000000000000000    0.000423735479149
       153          161    3.652897017214527    0.156644389755223    1.000000000000000    0.000190436483485
       154          162    3.652896690804817    0.088283433054916    1.000000000000000    0.000156740575785
       155          163    3.652896218164703    0.033848638854504    1.000000000000000    0.000256493845146
       156          164    3.652895161588233    0.114383909858759    1.000000000000000    0.000427006050858
       157          166    3.652892120067393    0.030054858086803    0.184187603002930    0.000474719760900
       158          167    3.652886595255687    0.537500005583425    1.000000000000000    0.000839670371804
       159          168    3.652881765807249    0.352795749778655    1.000000000000000    0.000929414532910
       160          170    3.652879385249375    0.466479073957601    0.221226708418035    0.000603693229803
       161          171    3.652875105558928    0.304016894885181    1.000000000000000    0.000302704284573
       162          172    3.652873438627494    0.196787226096693    1.000000000000000    0.000146030270502
       163          173    3.652872757873182    0.071183783840796    1.000000000000000    0.000187069159117
       164          175    3.652872734605185    0.001237104217566    0.022553821584627    0.000187727908942
       165          176    3.652870204534899    0.130515233849175    1.000000000000000    0.000391039098254
       166          177    3.652868428973248    0.147857061136106    1.000000000000000    0.000471000405225
       167          178    3.652865090490226    0.255670275241371    1.000000000000000    0.000470983466355
       168          179    3.652862277346480    0.241287241521188    1.000000000000000    0.000383612000687
       169          180    3.652860311214074    0.140110651641656    1.000000000000000    0.000166710745938
       170          181    3.652859690710765    0.058625938560701    1.000000000000000    0.000092500022146
       171          182    3.652859308088129    0.053152275035638    1.000000000000000    0.000125543123540
       172          183    3.652858640844114    0.050294910096930    1.000000000000000    0.000237319158612
       173          184    3.652857737834439    0.072257560274436    1.000000000000000    0.000217920228526
       174          185    3.652855561874158    0.200326937067699    1.000000000000000    0.000256403159230
       175          186    3.652854284737822    0.217535247579330    1.000000000000000    0.000323532741126
       176          187    3.652853364864227    0.152103334027191    1.000000000000000    0.000091603195950
       177          188    3.652853098116422    0.015041659699198    1.000000000000000    0.000082659140630
       178          189    3.652852678733057    0.023120397500891    1.000000000000000    0.000090332411242
       179          190    3.652851406793564    0.080381094263309    1.000000000000000    0.000223541239825
       180          191    3.652849969547406    0.105305047463471    1.000000000000000    0.000314929205178
       181          192    3.652848048355160    0.177963686678008    1.000000000000000    0.000298190813456
       182          194    3.652847760955776    0.052634714304167    0.147026177673369    0.000325132344130
       183          195    3.652846575513066    0.155053527773239    1.000000000000000    0.000139948836244
       184          196    3.652846163073691    0.063077521802995    1.000000000000000    0.000063302429257
       185          197    3.652845942721525    0.032025219470722    1.000000000000000    0.000121217626789
       186          198    3.652845667955330    0.031636734956661    1.000000000000000    0.000180826131723
       187          199    3.652844940222253    0.070191360043819    1.000000000000000    0.000272735121876
       188          200    3.652843654769583    0.125202440071269    1.000000000000000    0.000344569435631
       189          201    3.652841743145628    0.238411604354193    1.000000000000000    0.000313180593847
       190          203    3.652840667926649    0.202369985224427    0.312239275563390    0.000344708061418
       191          204    3.652839326995138    0.100018392656367    1.000000000000000    0.000211050558101
       192          205    3.652839045139923    0.085381939654503    1.000000000000000    0.000100151647849
       193          206    3.652838235611276    0.041719702357465    1.000000000000000    0.000103961542620
       194          207    3.652837718696882    0.076266396960477    1.000000000000000    0.000137061618825
       195          208    3.652836864903142    0.143202383802939    1.000000000000000    0.000196352942780
       196          209    3.652835640969556    0.156375943059080    1.000000000000000    0.000242364094123
       197          210    3.652834386580161    0.208502973492100    1.000000000000000    0.000212332607371
       198          211    3.652833848590452    0.149046211558066    1.000000000000000    0.000124576786784
       199          212    3.652833318231725    0.133263747024361    1.000000000000000    0.000124514582564
       200          214    3.652833309844651    0.002007529993048    0.022891745880104    0.000123955213834
       201          215    3.652832400823406    0.134915793295707    1.000000000000000    0.000060078566986
       202          216    3.652831905388567    0.050884234256923    1.000000000000000    0.000092203323603
       203          217    3.652830872861390    0.113067488652183    1.000000000000000    0.000158601445547
       204          218    3.652830148558622    0.173165175549352    1.000000000000000    0.000129544009090
       205          219    3.652829670156802    0.154782012359218    1.000000000000000    0.000108358925147
       206          220    3.652829494207913    0.084838584776922    1.000000000000000    0.000054689521418
       207          221    3.652829416765633    0.016745342603330    1.000000000000000    0.000082789504308
       208          222    3.652829317517817    0.014876075161538    1.000000000000000    0.000129581162267
       209          223    3.652828552028435    0.026783126861627    1.000000000000000    0.000149836558619
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0107e-01,-9.9541e-01,-6.0099e-01,-3.3425e-01,-5.5423e-01,-6.0598e-01,4.0067e-01,-4.2810e-01,-3.7496e-01,-5.0547e-01,-1.8298e+00,-5.5423e-01,2.0185e-01,1.8297e-01,-2.4239e+00,1.5611e+00,-1.0466e+00,-1.8298e+00,-2.0389e-01,5.9649e-01,-3.1400e+00,1.7297e+00,-1.2901e+00,-1.0466e+00,1.0704e-02,-5.1807e-01,-2.6565e-01,1.1665e-01,-1.4079e+00,-1.2901e+00,-4.2950e-01,6.8258e-01,-1.3501e+00,-3.7567e-02,-8.1186e-01,-1.4079e+00,8.7471e-01,-4.0351e-01,-2.7895e+00,4.4544e-01,-6.6970e-01,-8.1186e-01,-4.5800e-01,-3.4080e-01,-1.0433e+00,-1.1660e-01,-7.2604e-01,-6.6970e-01,-5.3725e-01,-4.7871e-01,-8.7198e-01,-5.0634e-01,-2.3410e-01,-7.2604e-01,-1.8468e-01,-7.1665e-01,-7.7486e-01,-4.5428e-01,-9.8985e-01,-2.3410e-01,-3.9120e-01,-5.5164e-01,-2.4237e-01,-2.6516e-01,-8.5172e-01,-9.8985e-01,-7.5908e-01,-1.7172e-01,-5.4640e-01,-3.6607e-01,-5.9695e-01,-8.5172e-01,9.1064e-02,9.0619e-02,9.1064e-02,8.7236e-02,9.1223e-02,1.1260e-01,9.1223e-02,1.0907e-01,9.1242e-02,-1.8864e+00,9.1242e-02,-1.1325e+00,9.6793e-02,-9.6793e-02,-1.1061e-02,1.1061e-02,6.2135e-01,-6.2135e-01,6.3352e-01,-6.3352e-01,8.8965e-01,-8.8965e-01,1.0835e+00,-1.0835e+00}
> Gradient:  {-5.6473e-06,-2.4926e-06,-3.1947e-06,1.3481e-07,-3.6727e-06,-4.1406e-07,-4.6025e-06,5.5548e-07,-1.1079e-06,-4.3135e-06,-2.1454e-06,-3.6727e-06,-5.5090e-06,1.2176e-06,7.8013e-07,-1.1372e-05,1.6172e-06,-2.1454e-06,-3.7751e-06,-3.3767e-06,-1.5647e-06,-9.2391e-06,9.2697e-07,1.6172e-06,-3.5929e-06,-3.6128e-06,-3.8581e-06,-4.4438e-06,-8.3080e-07,9.2697e-07,-4.1330e-06,-6.9403e-06,-4.8233e-06,-1.9905e-06,3.3065e-06,-8.3080e-07,-4.2728e-06,-4.0639e-06,-2.4420e-06,-8.7259e-06,7.8669e-07,3.3065e-06,-3.7665e-06,-4.2513e-06,-8.8197e-07,-3.5884e-06,-3.7099e-06,7.8669e-07,-4.6366e-07,-4.2898e-06,2.4232e-06,-6.1634e-06,-3.2079e-06,-3.7099e-06,-7.4954e-06,-1.3251e-06,-3.9495e-06,1.7070e-06,-1.1407e-06,-3.2079e-06,-2.0614e-06,-8.8707e-06,-2.2754e-06,-5.3598e-06,4.4215e-06,-1.1407e-06,-5.7358e-06,-8.2358e-06,-2.3867e-06,-2.8376e-06,-5.1197e-07,4.4215e-06,1.8213e-07,1.8124e-07,1.8213e-07,1.7447e-07,1.8245e-07,2.2521e-07,1.8245e-07,2.1814e-07,1.8248e-07,-3.6660e-06,1.8248e-07,-1.1075e-05,5.8297e-05,-5.8297e-05,9.5814e-06,-9.5814e-06,-2.1373e-05,2.1373e-05,3.8262e-06,-3.8262e-06,5.1744e-05,-5.1744e-05,6.2889e-05,-6.2889e-05}
>>>> Re-trying (1/3).
Gradient   = {-5.6394e-06,-2.4891e-06,-3.1839e-06,1.4198e-07,-3.6719e-06,-4.1311e-07,-4.5911e-06,5.6114e-07,-1.0993e-06,-4.3088e-06,-2.1454e-06,-3.6719e-06,-5.5036e-06,1.2234e-06,7.8072e-07,-1.1353e-05,1.6172e-06,-2.1454e-06,-3.7718e-06,-3.3699e-06,-1.5645e-06,-9.2185e-06,9.2704e-07,1.6172e-06,-3.5840e-06,-3.6070e-06,-3.8512e-06,-4.4345e-06,-8.3067e-07,9.2704e-07,-4.1283e-06,-6.9235e-06,-4.8213e-06,-1.9834e-06,3.3068e-06,-8.3067e-07,-4.2577e-06,-4.0594e-06,-2.4417e-06,-8.7157e-06,7.8728e-07,3.3068e-06,-3.7596e-06,-4.2430e-06,-8.7769e-07,-3.5784e-06,-3.7089e-06,7.8728e-07,-4.5678e-07,-4.2820e-06,2.4282e-06,-6.1556e-06,-3.2053e-06,-3.7089e-06,-7.4867e-06,-1.3181e-06,-3.9446e-06,1.7146e-06,-1.1403e-06,-3.2053e-06,-2.0553e-06,-8.8605e-06,-2.2686e-06,-5.3527e-06,4.4219e-06,-1.1403e-06,-5.7304e-06,-8.2216e-06,-2.3823e-06,-2.8317e-06,-5.1125e-07,4.4219e-06,1.8213e-07,1.8124e-07,1.8213e-07,1.7447e-07,1.8245e-07,2.2521e-07,1.8245e-07,2.1814e-07,1.8248e-07,-3.6563e-06,1.8248e-07,-1.1053e-05,5.8174e-05,-5.8174e-05,6.9372e-06,-6.9372e-06,-2.1328e-05,2.1328e-05,3.8187e-06,-3.8187e-06,5.1643e-05,-5.1643e-05,6.2770e-05,-6.2770e-05}
pCurr      = {5.6473e-06,2.4926e-06,3.1947e-06,-1.3480e-07,3.6727e-06,4.1406e-07,4.6025e-06,-5.5548e-07,1.1079e-06,4.3135e-06,2.1454e-06,3.6727e-06,5.5090e-06,-1.2176e-06,-7.8013e-07,1.1372e-05,-1.6172e-06,2.1454e-06,3.7751e-06,3.3767e-06,1.5647e-06,9.2392e-06,-9.2697e-07,-1.6172e-06,3.5929e-06,3.6128e-06,3.8581e-06,4.4438e-06,8.3080e-07,-9.2697e-07,4.1330e-06,6.9403e-06,4.8233e-06,1.9905e-06,-3.3065e-06,8.3080e-07,4.2728e-06,4.0639e-06,2.4420e-06,8.7259e-06,-7.8669e-07,-3.3065e-06,3.7665e-06,4.2513e-06,8.8197e-07,3.5884e-06,3.7099e-06,-7.8669e-07,4.6366e-07,4.2898e-06,-2.4232e-06,6.1634e-06,3.2079e-06,3.7099e-06,7.4954e-06,1.3251e-06,3.9495e-06,-1.7070e-06,1.1407e-06,3.2079e-06,2.0614e-06,8.8707e-06,2.2754e-06,5.3598e-06,-4.4215e-06,1.1407e-06,5.7358e-06,8.2358e-06,2.3867e-06,2.8376e-06,5.1197e-07,-4.4215e-06,-1.8213e-07,-1.8124e-07,-1.8213e-07,-1.7447e-07,-1.8245e-07,-2.2521e-07,-1.8245e-07,-2.1814e-07,-1.8248e-07,3.6660e-06,-1.8248e-07,1.1075e-05,-5.8297e-05,5.8297e-05,-6.9524e-06,6.9524e-06,2.1373e-05,-2.1373e-05,-3.8262e-06,3.8262e-06,-5.1744e-05,5.1744e-05,-6.2889e-05,6.2889e-05}
grad*pCur  = -2.2402944616773493E-8
parameters = {-2.0107e-01,-9.9541e-01,-6.0099e-01,-3.3425e-01,-5.5423e-01,-6.0598e-01,4.0067e-01,-4.2810e-01,-3.7496e-01,-5.0547e-01,-1.8298e+00,-5.5423e-01,2.0185e-01,1.8297e-01,-2.4239e+00,1.5611e+00,-1.0466e+00,-1.8298e+00,-2.0389e-01,5.9649e-01,-3.1400e+00,1.7297e+00,-1.2901e+00,-1.0466e+00,1.0704e-02,-5.1807e-01,-2.6565e-01,1.1665e-01,-1.4079e+00,-1.2901e+00,-4.2950e-01,6.8258e-01,-1.3501e+00,-3.7567e-02,-8.1186e-01,-1.4079e+00,8.7471e-01,-4.0351e-01,-2.7895e+00,4.4544e-01,-6.6970e-01,-8.1186e-01,-4.5800e-01,-3.4080e-01,-1.0433e+00,-1.1660e-01,-7.2604e-01,-6.6970e-01,-5.3725e-01,-4.7871e-01,-8.7198e-01,-5.0634e-01,-2.3410e-01,-7.2604e-01,-1.8468e-01,-7.1665e-01,-7.7486e-01,-4.5428e-01,-9.8985e-01,-2.3410e-01,-3.9120e-01,-5.5164e-01,-2.4237e-01,-2.6516e-01,-8.5172e-01,-9.8985e-01,-7.5908e-01,-1.7172e-01,-5.4640e-01,-3.6607e-01,-5.9695e-01,-8.5172e-01,9.1064e-02,9.0619e-02,9.1064e-02,8.7236e-02,9.1223e-02,1.1260e-01,9.1223e-02,1.0907e-01,9.1242e-02,-1.8864e+00,9.1242e-02,-1.1325e+00,9.6792e-02,-9.6792e-02,-1.1061e-02,1.1061e-02,6.2135e-01,-6.2135e-01,6.3352e-01,-6.3352e-01,8.8965e-01,-8.8965e-01,1.0835e+00,-1.0835e+00}
|grad|/|x| = 1.7116210528191516E-5
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0107e-01,-9.9541e-01,-6.0099e-01,-3.3425e-01,-5.5423e-01,-6.0598e-01,4.0067e-01,-4.2810e-01,-3.7496e-01,-5.0547e-01,-1.8298e+00,-5.5423e-01,2.0185e-01,1.8297e-01,-2.4239e+00,1.5611e+00,-1.0466e+00,-1.8298e+00,-2.0389e-01,5.9649e-01,-3.1400e+00,1.7297e+00,-1.2901e+00,-1.0466e+00,1.0704e-02,-5.1807e-01,-2.6565e-01,1.1665e-01,-1.4079e+00,-1.2901e+00,-4.2950e-01,6.8258e-01,-1.3501e+00,-3.7567e-02,-8.1186e-01,-1.4079e+00,8.7471e-01,-4.0351e-01,-2.7895e+00,4.4544e-01,-6.6970e-01,-8.1186e-01,-4.5800e-01,-3.4080e-01,-1.0433e+00,-1.1660e-01,-7.2604e-01,-6.6970e-01,-5.3725e-01,-4.7871e-01,-8.7198e-01,-5.0634e-01,-2.3410e-01,-7.2604e-01,-1.8468e-01,-7.1665e-01,-7.7486e-01,-4.5428e-01,-9.8985e-01,-2.3410e-01,-3.9120e-01,-5.5164e-01,-2.4237e-01,-2.6516e-01,-8.5172e-01,-9.8985e-01,-7.5908e-01,-1.7172e-01,-5.4640e-01,-3.6607e-01,-5.9695e-01,-8.5172e-01,9.1064e-02,9.0619e-02,9.1064e-02,8.7236e-02,9.1223e-02,1.1260e-01,9.1223e-02,1.0907e-01,9.1242e-02,-1.8864e+00,9.1242e-02,-1.1325e+00,9.6793e-02,-9.6793e-02,-1.1061e-02,1.1061e-02,6.2135e-01,-6.2135e-01,6.3352e-01,-6.3352e-01,8.8965e-01,-8.8965e-01,1.0835e+00,-1.0835e+00}
> Gradient:  {-5.6394e-06,-2.4891e-06,-3.1839e-06,1.4198e-07,-3.6719e-06,-4.1311e-07,-4.5911e-06,5.6114e-07,-1.0993e-06,-4.3088e-06,-2.1454e-06,-3.6719e-06,-5.5036e-06,1.2234e-06,7.8072e-07,-1.1353e-05,1.6172e-06,-2.1454e-06,-3.7718e-06,-3.3699e-06,-1.5645e-06,-9.2185e-06,9.2704e-07,1.6172e-06,-3.5840e-06,-3.6070e-06,-3.8512e-06,-4.4345e-06,-8.3067e-07,9.2704e-07,-4.1283e-06,-6.9235e-06,-4.8213e-06,-1.9834e-06,3.3068e-06,-8.3067e-07,-4.2577e-06,-4.0594e-06,-2.4417e-06,-8.7157e-06,7.8728e-07,3.3068e-06,-3.7596e-06,-4.2430e-06,-8.7769e-07,-3.5784e-06,-3.7089e-06,7.8728e-07,-4.5678e-07,-4.2820e-06,2.4282e-06,-6.1556e-06,-3.2053e-06,-3.7089e-06,-7.4867e-06,-1.3181e-06,-3.9446e-06,1.7146e-06,-1.1403e-06,-3.2053e-06,-2.0553e-06,-8.8605e-06,-2.2686e-06,-5.3527e-06,4.4219e-06,-1.1403e-06,-5.7304e-06,-8.2216e-06,-2.3823e-06,-2.8317e-06,-5.1125e-07,4.4219e-06,1.8213e-07,1.8124e-07,1.8213e-07,1.7447e-07,1.8245e-07,2.2521e-07,1.8245e-07,2.1814e-07,1.8248e-07,-3.6563e-06,1.8248e-07,-1.1053e-05,5.8174e-05,-5.8174e-05,6.9372e-06,-6.9372e-06,-2.1328e-05,2.1328e-05,3.8187e-06,-3.8187e-06,5.1643e-05,-5.1643e-05,6.2770e-05,-6.2770e-05}
>>>> Re-trying (2/3).
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.0107e-01,-9.9541e-01,-6.0099e-01,-3.3425e-01,-5.5423e-01,-6.0598e-01,4.0067e-01,-4.2810e-01,-3.7496e-01,-5.0547e-01,-1.8298e+00,-5.5423e-01,2.0185e-01,1.8297e-01,-2.4239e+00,1.5611e+00,-1.0466e+00,-1.8298e+00,-2.0389e-01,5.9649e-01,-3.1400e+00,1.7297e+00,-1.2901e+00,-1.0466e+00,1.0704e-02,-5.1807e-01,-2.6565e-01,1.1665e-01,-1.4079e+00,-1.2901e+00,-4.2950e-01,6.8258e-01,-1.3501e+00,-3.7567e-02,-8.1186e-01,-1.4079e+00,8.7471e-01,-4.0351e-01,-2.7895e+00,4.4544e-01,-6.6970e-01,-8.1186e-01,-4.5800e-01,-3.4080e-01,-1.0433e+00,-1.1660e-01,-7.2604e-01,-6.6970e-01,-5.3725e-01,-4.7871e-01,-8.7198e-01,-5.0634e-01,-2.3410e-01,-7.2604e-01,-1.8468e-01,-7.1665e-01,-7.7486e-01,-4.5428e-01,-9.8985e-01,-2.3410e-01,-3.9120e-01,-5.5164e-01,-2.4237e-01,-2.6516e-01,-8.5172e-01,-9.8985e-01,-7.5908e-01,-1.7172e-01,-5.4640e-01,-3.6607e-01,-5.9695e-01,-8.5172e-01,9.1064e-02,9.0619e-02,9.1064e-02,8.7236e-02,9.1223e-02,1.1260e-01,9.1223e-02,1.0907e-01,9.1242e-02,-1.8864e+00,9.1242e-02,-1.1325e+00,9.6793e-02,-9.6793e-02,-1.1061e-02,1.1061e-02,6.2135e-01,-6.2135e-01,6.3352e-01,-6.3352e-01,8.8965e-01,-8.8965e-01,1.0835e+00,-1.0835e+00}
> Gradient:  {-5.6473e-06,-2.4926e-06,-3.1947e-06,1.3480e-07,-3.6727e-06,-4.1406e-07,-4.6025e-06,5.5548e-07,-1.1079e-06,-4.3135e-06,-2.1454e-06,-3.6727e-06,-5.5090e-06,1.2176e-06,7.8013e-07,-1.1372e-05,1.6172e-06,-2.1454e-06,-3.7751e-06,-3.3767e-06,-1.5647e-06,-9.2392e-06,9.2697e-07,1.6172e-06,-3.5929e-06,-3.6128e-06,-3.8581e-06,-4.4438e-06,-8.3080e-07,9.2697e-07,-4.1330e-06,-6.9403e-06,-4.8233e-06,-1.9905e-06,3.3065e-06,-8.3080e-07,-4.2728e-06,-4.0639e-06,-2.4420e-06,-8.7259e-06,7.8669e-07,3.3065e-06,-3.7665e-06,-4.2513e-06,-8.8197e-07,-3.5884e-06,-3.7099e-06,7.8669e-07,-4.6366e-07,-4.2898e-06,2.4232e-06,-6.1634e-06,-3.2079e-06,-3.7099e-06,-7.4954e-06,-1.3251e-06,-3.9495e-06,1.7070e-06,-1.1407e-06,-3.2079e-06,-2.0614e-06,-8.8707e-06,-2.2754e-06,-5.3598e-06,4.4215e-06,-1.1407e-06,-5.7358e-06,-8.2358e-06,-2.3867e-06,-2.8376e-06,-5.1197e-07,4.4215e-06,1.8213e-07,1.8124e-07,1.8213e-07,1.7447e-07,1.8245e-07,2.2521e-07,1.8245e-07,2.1814e-07,1.8248e-07,-3.6660e-06,1.8248e-07,-1.1075e-05,5.8297e-05,-5.8297e-05,6.9524e-06,-6.9524e-06,-2.1373e-05,2.1373e-05,3.8262e-06,-3.8262e-06,5.1744e-05,-5.1744e-05,6.2889e-05,-6.2889e-05}
>>>> Re-trying (3/3).
After: gradient norm = 1.498230373225234E-4
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0968,-0.0968}

Count Table 1:
---------------
h:                 {-0.0111,0.0111}

Count Table 2:
---------------
h:                 {0.6214,-0.6214}

Count Table 3:
---------------
h:                 {0.6335,-0.6335}

Count Table 4:
---------------
h:                 {0.8896,-0.8896}

Count Table 5:
---------------
h:                 {1.0835,-1.0835}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {-0.2011,-0.9954,-0.6010,-0.3343,-0.5542,-0.6060,0.4007,-0.4281,-0.3750,-0.5055,-1.8298,-0.5542,0.2018,0.1830,-2.4239,1.5611,-1.0466,-1.8298,-0.2039,0.5965,-3.1400,1.7297,-1.2901,-1.0466,0.0107,-0.5181,-0.2656,0.1166,-1.4079,-1.2901,-0.4295,0.6826,-1.3501,-0.0376,-0.8119,-1.4079,0.8747,-0.4035,-2.7895,0.4454,-0.6697,-0.8119,-0.4580,-0.3408,-1.0433,-0.1166,-0.7260,-0.6697,-0.5372,-0.4787,-0.8720,-0.5063,-0.2341,-0.7260,-0.1847,-0.7166,-0.7749,-0.4543,-0.9899,-0.2341,-0.3912,-0.5516,-0.2424,-0.2652,-0.8517,-0.9899,-0.7591,-0.1717,-0.5464,-0.3661,-0.5969,-0.8517}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0911,0.0906}
Activity(exp=1):   {0.0911,0.0872}
Activity(exp=2):   {0.0912,0.1126}
Activity(exp=3):   {0.0912,0.1091}
Activity(exp=4):   {0.0912,-1.8864}
Activity(exp=5):   {0.0912,-1.1325}

Suggested variations:
key=12;3;0, description = Initial model.
> Optimizing variation "Initial model." (component3-2-variation0).
>>  Starting new optimization: component3-2-variation0. (2021-05-21 19:41:56.262).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[84,85]},{"h":[86,87]},{"h":[88,89]},{"h":[90,91]},{"h":[92,93]},{"h":[94,95]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71],"activity":[[72,73],[74,75],[76,77],[78,79],[80,81],[82,83]]}]}

Value and gradient before optimization:
=======================================
value         = 3.6528291101132075
gradient      = {-0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0001,-0.0001,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0001,-0.0001,0.0001,-0.0001}
gradient norm = 1.4982316985015555E-4
Starting Function Value: 3.6528291101132075
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.652829082760777    0.000345085386788    2.303284512891447    0.000021399123239
         2            4    3.652829081726262    0.000052599340278    1.000000000000000    0.000020290975368
         3            5    3.652829072185434    0.000636156066363    1.000000000000000    0.000052571669021
         4            6    3.652829054398493    0.001436293265091    1.000000000000000    0.000101542411197
         5            7    3.652829010930692    0.003995719404134    1.000000000000000    0.000167391952798
         6            8    3.652828984108625    0.007105714256017    1.000000000000000    0.000196521598007
         7            9    3.652828846493875    0.010225842285437    1.000000000000000    0.000171358491038
         8           11    3.652828830446076    0.002619692054817    0.220725039024903    0.000181832264238
         9           12    3.652828767853709    0.007335606481432    1.000000000000000    0.000057832879352
        10           13    3.652828759204226    0.000584741448602    1.000000000000000    0.000025086862476
        11           14    3.652828754302299    0.000793892598998    1.000000000000000    0.000037434781649
        12           15    3.652828746272443    0.000847197367220    1.000000000000000    0.000051697570514
        13           18    3.652828727928184    0.001736434486092    0.660000000000000    0.000071030127518
        14           19    3.652825909966905    0.004857053133208    1.000000000000000    0.000074648159034
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9901e-01,-9.9409e-01,-6.0330e-01,-3.3966e-01,-5.4780e-01,-6.0673e-01,3.9803e-01,-4.3374e-01,-3.7993e-01,-5.0188e-01,-1.8253e+00,-5.4780e-01,2.0788e-01,1.7664e-01,-2.4261e+00,1.5642e+00,-1.0501e+00,-1.8253e+00,-1.9908e-01,5.9683e-01,-3.1368e+00,1.7286e+00,-1.2922e+00,-1.0501e+00,1.0340e-02,-5.1665e-01,-2.6487e-01,1.1696e-01,-1.4064e+00,-1.2922e+00,-4.2679e-01,6.8225e-01,-1.3423e+00,-4.0302e-02,-8.1931e-01,-1.4064e+00,8.7333e-01,-4.0032e-01,-2.7846e+00,4.5036e-01,-6.7229e-01,-8.1931e-01,-4.5702e-01,-3.4036e-01,-1.0454e+00,-1.1796e-01,-7.1979e-01,-6.7229e-01,-5.4201e-01,-4.7732e-01,-8.7981e-01,-5.0165e-01,-2.3223e-01,-7.1979e-01,-1.7908e-01,-7.2003e-01,-7.7197e-01,-4.6151e-01,-9.8799e-01,-2.3223e-01,-3.9188e-01,-5.4634e-01,-2.4139e-01,-2.6159e-01,-8.6142e-01,-9.8799e-01,-7.5259e-01,-1.7020e-01,-5.4475e-01,-3.6518e-01,-5.9647e-01,-8.6142e-01,9.0671e-02,9.0228e-02,9.0671e-02,8.6859e-02,9.0829e-02,1.1212e-01,9.0829e-02,1.0860e-01,9.0848e-02,-1.8869e+00,9.0848e-02,-1.1319e+00,9.6678e-02,-9.6678e-02,-1.1069e-02,1.1069e-02,6.2142e-01,-6.2142e-01,6.3352e-01,-6.3352e-01,8.8965e-01,-8.8965e-01,1.0838e+00,-1.0838e+00}
> Gradient:  {6.6784e-06,7.9066e-07,7.6296e-07,2.2950e-06,-1.8970e-06,1.2746e-06,8.4073e-06,1.3123e-06,1.2131e-06,2.9561e-06,-2.0873e-06,-1.8970e-06,-8.6243e-07,-1.3981e-06,8.3228e-07,1.1727e-05,1.5685e-06,-2.0873e-06,-1.8228e-06,-8.9032e-08,-1.5164e-06,1.0709e-05,9.3112e-07,1.5685e-06,2.5255e-06,1.6036e-06,3.4524e-07,5.0657e-06,-6.9089e-07,9.3112e-07,2.7777e-06,3.6631e-06,-3.1168e-06,4.0199e-06,3.1272e-06,-6.9089e-07,1.9614e-06,-3.1470e-07,-2.2949e-06,6.1979e-06,1.1033e-06,3.1272e-06,3.8633e-06,2.8521e-06,6.8844e-07,3.2054e-06,-1.9322e-06,1.1033e-06,3.5729e-06,1.7521e-06,-8.7615e-08,4.6513e-06,1.8238e-06,-1.9322e-06,4.7456e-06,1.4255e-06,1.5847e-06,9.9155e-07,-7.9093e-07,1.8238e-06,1.7025e-06,4.9001e-06,-2.0346e-06,2.5834e-06,3.5441e-06,-7.9093e-07,-3.3611e-07,6.1726e-06,-4.0198e-07,1.4930e-06,-5.6696e-07,3.5441e-06,1.8134e-07,1.8046e-07,1.8134e-07,1.7372e-07,1.8166e-07,2.2423e-07,1.8166e-07,2.1720e-07,1.8170e-07,2.6116e-06,1.8170e-07,7.8366e-06,6.0069e-06,-6.0069e-06,3.4567e-06,-3.4567e-06,1.2721e-05,-1.2721e-05,1.9246e-06,-1.9246e-06,2.0554e-05,-2.0554e-05,4.1296e-05,-4.1296e-05}
>>>> Re-trying (1/3).
Starting Function Value: 3.652828684281938
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            4    3.652828682996110    0.000017859817595    0.239922424103087    0.000069635935112
         2            5    3.652828667758738    0.000366984742989    1.000000000000000    0.000048326377375
         3            6    3.652828659197573    0.000303298944369    1.000000000000000    0.000060777966941
         4            7    3.652828635638545    0.001134734000896    1.000000000000000    0.000063812245288
         5            9    3.652828599111408    0.000164936154853    0.186898275681682    0.000054099877379
         6           10    3.652828577515375    0.001209254976095    1.000000000000000    0.000033150179498
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9966e-01,-9.9420e-01,-6.0342e-01,-3.3982e-01,-5.4760e-01,-6.0690e-01,3.9724e-01,-4.3393e-01,-3.8014e-01,-5.0215e-01,-1.8250e+00,-5.4760e-01,2.0798e-01,1.7671e-01,-2.4262e+00,1.5631e+00,-1.0503e+00,-1.8250e+00,-1.9887e-01,5.9674e-01,-3.1366e+00,1.7276e+00,-1.2923e+00,-1.0503e+00,1.0119e-02,-5.1684e-01,-2.6498e-01,1.1654e-01,-1.4063e+00,-1.2923e+00,-4.2707e-01,6.8190e-01,-1.3419e+00,-4.0672e-02,-8.1971e-01,-1.4063e+00,8.7327e-01,-4.0033e-01,-2.7843e+00,4.4974e-01,-6.7245e-01,-8.1971e-01,-4.5738e-01,-3.4065e-01,-1.0455e+00,-1.1821e-01,-7.1959e-01,-6.7245e-01,-5.4235e-01,-4.7749e-01,-8.7982e-01,-5.0206e-01,-2.3248e-01,-7.1959e-01,-1.7954e-01,-7.2018e-01,-7.7218e-01,-4.6151e-01,-9.8790e-01,-2.3248e-01,-3.9200e-01,-5.4687e-01,-2.4113e-01,-2.6182e-01,-8.6186e-01,-9.8790e-01,-7.5253e-01,-1.7078e-01,-5.4470e-01,-3.6530e-01,-5.9642e-01,-8.6186e-01,9.0649e-02,9.0206e-02,9.0649e-02,8.6838e-02,9.0807e-02,1.1209e-01,9.0807e-02,1.0857e-01,9.0826e-02,-1.8872e+00,9.0826e-02,-1.1327e+00,9.6674e-02,-9.6674e-02,-1.1066e-02,1.1066e-02,6.2142e-01,-6.2142e-01,6.3352e-01,-6.3352e-01,8.8942e-01,-8.8942e-01,1.0833e+00,-1.0833e+00}
> Gradient:  {-3.3003e-07,-5.1599e-07,-3.2019e-06,-3.2442e-06,-1.7533e-06,1.0749e-06,-1.4672e-06,-6.4625e-07,-1.1219e-06,-9.0756e-07,-2.0744e-06,-1.7533e-06,-3.0085e-06,-1.8311e-06,8.6941e-07,-3.6491e-06,1.5987e-06,-2.0744e-06,-2.8636e-06,-1.0063e-06,-1.4973e-06,-5.3016e-06,9.7511e-07,1.5987e-06,-3.0722e-06,-9.4676e-07,-1.3439e-06,-3.0835e-06,-6.2377e-07,9.7511e-07,-5.3441e-07,-5.4665e-06,-3.2999e-06,-1.4740e-06,3.3036e-06,-6.2377e-07,-7.8687e-06,-1.3432e-06,-2.2606e-06,-1.2587e-06,1.3326e-06,3.3036e-06,-1.4600e-06,-1.8849e-06,-4.7624e-07,-3.8730e-06,-1.7334e-06,1.3326e-06,-1.2904e-06,-2.3935e-06,-1.6743e-06,-1.9406e-06,9.3723e-07,-1.7334e-06,-1.6197e-06,-2.0069e-06,-2.2784e-07,-4.4086e-06,-7.6922e-07,9.3723e-07,-2.5381e-06,-1.0591e-06,-4.8946e-06,-2.2617e-06,3.5521e-06,-7.6922e-07,-3.0054e-06,-3.5393e-06,-2.0401e-06,-2.3087e-06,-6.2931e-07,3.5521e-06,1.8130e-07,1.8041e-07,1.8130e-07,1.7368e-07,1.8161e-07,2.2418e-07,1.8161e-07,2.1714e-07,1.8165e-07,-2.3023e-06,1.8165e-07,-5.1249e-06,4.0579e-06,-4.0579e-06,4.6420e-06,-4.6420e-06,1.0350e-05,-1.0350e-05,7.6435e-07,-7.6435e-07,5.6438e-06,-5.6438e-06,1.1659e-05,-1.1659e-05}
>>>> Re-trying (2/3).
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-1.9966e-01,-9.9420e-01,-6.0342e-01,-3.3982e-01,-5.4760e-01,-6.0690e-01,3.9724e-01,-4.3393e-01,-3.8014e-01,-5.0215e-01,-1.8250e+00,-5.4760e-01,2.0798e-01,1.7671e-01,-2.4262e+00,1.5631e+00,-1.0503e+00,-1.8250e+00,-1.9887e-01,5.9674e-01,-3.1366e+00,1.7276e+00,-1.2923e+00,-1.0503e+00,1.0119e-02,-5.1684e-01,-2.6498e-01,1.1654e-01,-1.4063e+00,-1.2923e+00,-4.2707e-01,6.8190e-01,-1.3419e+00,-4.0672e-02,-8.1971e-01,-1.4063e+00,8.7327e-01,-4.0033e-01,-2.7843e+00,4.4974e-01,-6.7245e-01,-8.1971e-01,-4.5738e-01,-3.4065e-01,-1.0455e+00,-1.1821e-01,-7.1959e-01,-6.7245e-01,-5.4235e-01,-4.7749e-01,-8.7982e-01,-5.0206e-01,-2.3248e-01,-7.1959e-01,-1.7954e-01,-7.2018e-01,-7.7218e-01,-4.6151e-01,-9.8790e-01,-2.3248e-01,-3.9200e-01,-5.4687e-01,-2.4113e-01,-2.6182e-01,-8.6186e-01,-9.8790e-01,-7.5253e-01,-1.7078e-01,-5.4470e-01,-3.6530e-01,-5.9642e-01,-8.6186e-01,9.0649e-02,9.0206e-02,9.0649e-02,8.6838e-02,9.0807e-02,1.1209e-01,9.0807e-02,1.0857e-01,9.0826e-02,-1.8872e+00,9.0826e-02,-1.1327e+00,9.6674e-02,-9.6674e-02,-1.1066e-02,1.1066e-02,6.2142e-01,-6.2142e-01,6.3352e-01,-6.3352e-01,8.8942e-01,-8.8942e-01,1.0833e+00,-1.0833e+00}
> Gradient:  {-3.3002e-07,-5.1599e-07,-3.2019e-06,-3.2439e-06,-1.7533e-06,1.0749e-06,-1.4671e-06,-6.4624e-07,-1.1219e-06,-9.0734e-07,-2.0744e-06,-1.7533e-06,-3.0085e-06,-1.8311e-06,8.6941e-07,-3.6488e-06,1.5987e-06,-2.0744e-06,-2.8636e-06,-1.0063e-06,-1.4973e-06,-5.3012e-06,9.7511e-07,1.5987e-06,-3.0722e-06,-9.4664e-07,-1.3439e-06,-3.0833e-06,-6.2377e-07,9.7511e-07,-5.3440e-07,-5.4664e-06,-3.2999e-06,-1.4738e-06,3.3036e-06,-6.2377e-07,-7.8687e-06,-1.3431e-06,-2.2606e-06,-1.2584e-06,1.3326e-06,3.3036e-06,-1.4600e-06,-1.8846e-06,-4.7624e-07,-3.8729e-06,-1.7334e-06,1.3326e-06,-1.2904e-06,-2.3933e-06,-1.6743e-06,-1.9404e-06,9.3723e-07,-1.7334e-06,-1.6196e-06,-2.0068e-06,-2.2784e-07,-4.4084e-06,-7.6922e-07,9.3723e-07,-2.5380e-06,-1.0590e-06,-4.8946e-06,-2.2615e-06,3.5521e-06,-7.6922e-07,-3.0053e-06,-3.5391e-06,-2.0401e-06,-2.3085e-06,-6.2931e-07,3.5521e-06,1.8130e-07,1.8041e-07,1.8130e-07,1.7368e-07,1.8161e-07,2.2418e-07,1.8161e-07,2.1714e-07,1.8165e-07,-2.3019e-06,1.8165e-07,-5.1249e-06,4.0579e-06,-4.0579e-06,4.6420e-06,-4.6420e-06,1.0350e-05,-1.0350e-05,7.6435e-07,-7.6435e-07,5.6436e-06,-5.6436e-06,1.1659e-05,-1.1659e-05}
>>>> Re-trying (3/3).
After: gradient norm = 3.31423356172144E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0111,0.0111}

Count Table 2:
---------------
h:                 {0.6214,-0.6214}

Count Table 3:
---------------
h:                 {0.6335,-0.6335}

Count Table 4:
---------------
h:                 {0.8894,-0.8894}

Count Table 5:
---------------
h:                 {1.0833,-1.0833}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {-0.1997,-0.9942,-0.6034,-0.3398,-0.5476,-0.6069,0.3972,-0.4339,-0.3801,-0.5022,-1.8250,-0.5476,0.2080,0.1767,-2.4262,1.5631,-1.0503,-1.8250,-0.1989,0.5967,-3.1366,1.7276,-1.2923,-1.0503,0.0101,-0.5168,-0.2650,0.1165,-1.4063,-1.2923,-0.4271,0.6819,-1.3419,-0.0407,-0.8197,-1.4063,0.8733,-0.4003,-2.7843,0.4497,-0.6725,-0.8197,-0.4574,-0.3406,-1.0455,-0.1182,-0.7196,-0.6725,-0.5423,-0.4775,-0.8798,-0.5021,-0.2325,-0.7196,-0.1795,-0.7202,-0.7722,-0.4615,-0.9879,-0.2325,-0.3920,-0.5469,-0.2411,-0.2618,-0.8619,-0.9879,-0.7525,-0.1708,-0.5447,-0.3653,-0.5964,-0.8619}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0906,0.0902}
Activity(exp=1):   {0.0906,0.0868}
Activity(exp=2):   {0.0908,0.1121}
Activity(exp=3):   {0.0908,0.1086}
Activity(exp=4):   {0.0908,-1.8872}
Activity(exp=5):   {0.0908,-1.1327}

  The Likelihood DID improve.
Suggested variations:
key=12;4;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component3-2-variation1).
>>  Starting new optimization: component3-2-variation1. (2021-05-21 19:43:51.47).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[84,85]},{"h":[86,87]},{"h":[88,89]},{"h":[90,91]},{"h":[92,93]},{"h":[94,95]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71],"activity":[[72,73],[74,75],[76,77],[78,79],[80,81],[82,83]]}]}

Value and gradient before optimization:
=======================================
value         = 3.6528095258349493
gradient      = {0.0003,0.0001,0.0003,0.0002,0.0000,0.0000,0.0004,0.0001,0.0003,0.0001,-0.0000,0.0000,0.0002,0.0002,0.0000,0.0006,0.0000,-0.0000,0.0001,0.0002,0.0000,0.0006,0.0000,0.0000,0.0003,0.0002,0.0002,0.0002,0.0000,0.0000,0.0002,0.0005,0.0001,0.0002,0.0000,0.0000,0.0005,0.0001,0.0000,0.0003,0.0000,0.0000,0.0003,0.0002,0.0001,0.0003,0.0000,0.0000,0.0002,0.0004,0.0001,0.0002,0.0000,0.0000,0.0002,0.0004,0.0001,0.0002,0.0000,0.0000,0.0003,0.0003,0.0001,0.0002,0.0000,0.0000,0.0001,0.0004,0.0002,0.0002,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0002,0.0000,0.0007,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0017,0.0017,-0.0029,0.0029}
gradient norm = 0.005135725870530885
Starting Function Value: 3.6528095258349493
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.652777783179515    0.012380622296478    2.410685968953088    0.000503444874018
         2            4    3.652777640984004    0.001205287315399    1.000000000000000    0.000470996162068
         3            5    3.652770711213181    0.026200193123446    1.000000000000000    0.000267869934695
         4            6    3.652768123047177    0.013320376402662    1.000000000000000    0.000407164748814
         5            7    3.652757868260888    0.112939460593230    1.000000000000000    0.000997055463201
         6           10    3.652757245467225    0.003310726846732    0.092065026065208    0.000693497357921
         7           11    3.652756365393346    0.004407789854366    1.000000000000000    0.000121644613435
         8           12    3.652756326339166    0.001446518141152    1.000000000000000    0.000086066068313
         9           15    3.652756319583061    0.000894571306876    0.660000000000000    0.000083578931182
        10           16    3.652756132588262    0.003738958861260    1.000000000000000    0.000192572155108
        11           17    3.652755889057877    0.005847565418088    1.000000000000000    0.000323803806199
        12           18    3.652755268831102    0.015883594152747    1.000000000000000    0.000501793109547
        13           19    3.652754205166453    0.031819318203702    1.000000000000000    0.000622340645068
        14           20    3.652753509033063    0.038530256246318    1.000000000000000    0.000630475948387
        15           21    3.652752921101492    0.007077386959248    1.000000000000000    0.000243130483112
        16           22    3.652752781220583    0.004049859072169    1.000000000000000    0.000074191663066
        17           23    3.652752775776930    0.000770106461157    1.000000000000000    0.000066352320685
        18           24    3.652752734754457    0.001304591012388    1.000000000000000    0.000116665797475
        19           25    3.652752619119644    0.003610462027602    1.000000000000000    0.000231649816876
        20           26    3.652752391668982    0.009076548509148    1.000000000000000    0.000383908612571
        21           29    3.652752068582828    0.012816917617544    0.660000000000000    0.000461966633059
        22           30    3.652751429459020    0.033620082553819    1.000000000000000    0.000424810007363
        23           32    3.652751413273609    0.001175132432158    0.033031842739761    0.000421177464856
        24           33    3.652751181540714    0.013983589189060    1.000000000000000    0.000218382337133
        25           34    3.652751106277580    0.002912541015892    1.000000000000000    0.000043229573460
        26           36    3.652751106008156    0.000038022755017    0.019004141678580    0.000042692818406
        27           37    3.652751088462514    0.003284301222061    1.000000000000000    0.000052720711336
        28           38    3.652751077344683    0.000998425299198    1.000000000000000    0.000069118258681
        29           39    3.652751002583788    0.004304088346357    1.000000000000000    0.000143271386744
        30           40    3.652750887153343    0.006926877276217    1.000000000000000    0.000210530210223
        31           43    3.652750725921189    0.010674383167645    0.660000000000000    0.000233182537703
        32           44    3.652750439328565    0.027723594440057    1.000000000000000    0.000175708902286
        33           45    3.652750318822687    0.017752100718206    1.000000000000000    0.000075356591329
        34           46    3.652750190193609    0.013909996403431    1.000000000000000    0.000073994174343
        35           47    3.652750148460428    0.004899809540488    1.000000000000000    0.000124578359568
        36           48    3.652750059989596    0.008815520834277    1.000000000000000    0.000186139610787
        37           49    3.652749912624865    0.015018961767046    1.000000000000000    0.000219333448144
        38           50    3.652749709921477    0.023479495346408    1.000000000000000    0.000174053471773
        39           51    3.652749577300091    0.018602485519643    1.000000000000000    0.000061332241175
        40           52    3.652749535965929    0.006547942538636    1.000000000000000    0.000035987055646
        41           53    3.652749522318968    0.002147609853660    1.000000000000000    0.000061708819323
        42           54    3.652749497536921    0.002799759262709    1.000000000000000    0.000088735494831
        43           55    3.652749377432282    0.005249662044958    1.000000000000000    0.000119008702979
        44           56    3.652749146389626    0.013179556305592    1.000000000000000    0.000130750680338
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.3792e-01,-9.9034e-01,-6.0181e-01,-3.1199e-01,-6.0484e-01,-6.2091e-01,3.6752e-01,-4.4949e-01,-4.1230e-01,-4.6607e-01,-1.8026e+00,-6.0484e-01,1.7168e-01,1.1897e-01,-2.4485e+00,1.6047e+00,-1.0728e+00,-1.8026e+00,-2.7871e-01,5.6440e-01,-3.1325e+00,1.8049e+00,-1.3138e+00,-1.0728e+00,-4.1016e-03,-6.0216e-01,-2.5412e-01,1.5866e-01,-1.4130e+00,-1.3138e+00,-4.6859e-01,6.9647e-01,-1.3377e+00,-2.3646e-02,-8.8208e-01,-1.4130e+00,8.9107e-01,-3.8288e-01,-2.7454e+00,4.2781e-01,-7.3706e-01,-8.8208e-01,-5.0875e-01,-3.1503e-01,-1.0702e+00,-9.2879e-02,-7.0457e-01,-7.3706e-01,-5.8318e-01,-5.1479e-01,-8.4916e-01,-5.4975e-01,-2.2704e-01,-7.0457e-01,-1.5669e-01,-8.1777e-01,-7.4639e-01,-4.9793e-01,-9.8268e-01,-2.2704e-01,-4.3795e-01,-5.5753e-01,-2.1064e-01,-2.7220e-01,-9.0680e-01,-9.8268e-01,-7.6090e-01,-1.6862e-01,-5.6630e-01,-3.9446e-01,-5.7072e-01,-9.0680e-01,8.8451e-02,8.8018e-02,8.8451e-02,8.4732e-02,8.8605e-02,1.0937e-01,8.8605e-02,1.0594e-01,8.8623e-02,-1.9303e+00,8.8623e-02,-1.1724e+00,9.6683e-02,-9.6683e-02,-1.1222e-02,1.1222e-02,6.2149e-01,-6.2149e-01,6.3352e-01,-6.3352e-01,8.8956e-01,-8.8956e-01,1.0836e+00,-1.0836e+00}
> Gradient:  {4.4842e-06,1.0325e-07,4.0056e-06,5.3723e-06,-6.8726e-07,-9.7710e-07,6.2896e-06,-6.8641e-07,5.0177e-06,4.1471e-06,-1.7797e-06,-6.8726e-07,9.6185e-07,-1.1635e-06,1.6165e-06,1.1017e-05,1.5272e-06,-1.7797e-06,-8.2539e-07,1.5717e-06,-4.2023e-07,8.8839e-06,1.4425e-06,1.5272e-06,7.7960e-08,-5.1634e-07,6.8076e-06,4.1382e-06,2.2967e-07,1.4425e-06,8.8826e-07,1.3308e-05,-3.1209e-06,-2.4814e-06,3.3563e-06,2.2967e-07,1.7706e-06,1.1991e-06,-3.6863e-06,8.0308e-06,1.5091e-06,3.3563e-06,2.2531e-06,4.2850e-06,6.2321e-07,3.3959e-06,1.1326e-07,1.5091e-06,1.6287e-06,5.0438e-06,4.6298e-07,4.3211e-06,6.0971e-07,1.1326e-07,2.3392e-06,4.1836e-06,1.0558e-06,4.3728e-06,-3.8142e-07,6.0971e-07,9.4262e-07,3.3980e-06,1.5392e-06,4.8034e-06,1.9992e-06,-3.8142e-07,-1.1834e-06,7.4174e-06,8.6448e-07,4.2033e-06,-9.9998e-07,1.9992e-06,1.7690e-07,1.7604e-07,1.7690e-07,1.6946e-07,1.7721e-07,2.1874e-07,1.7721e-07,2.1188e-07,1.7725e-07,5.2668e-06,1.7725e-07,7.5644e-06,7.8941e-06,-7.8941e-06,-6.8987e-05,6.8987e-05,4.2519e-05,-4.2519e-05,1.0762e-06,-1.0762e-06,1.1520e-05,-1.1520e-05,-3.5445e-05,3.5445e-05}
>>>> Re-trying (1/3).
Starting Function Value: 3.652749343595102
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.652749315403413    0.000290445694883    2.220226288556973    0.000025349881533
         2            4    3.652749314027747    0.000059191764632    1.000000000000000    0.000023768883006
         3            5    3.652749283502824    0.000772656644714    1.000000000000000    0.000048194925288
         4            7    3.652749276261608    0.000062661963719    0.055377800930338    0.000048361662921
         5            8    3.652749272274128    0.002987351349472    1.000000000000000    0.000097175072850
         6            9    3.652749262487859    0.003074821664124    1.000000000000000    0.000093310081486
         7           11    3.652749258834712    0.000082548315649    0.133835886303821    0.000084075293011
         8           12    3.652749206282624    0.001022298675790    1.000000000000000    0.000047902287339
Gradient   = {-1.7017e-06,-1.2487e-06,-8.4613e-07,-6.0433e-07,-5.5949e-07,-1.1892e-06,-2.0989e-06,-2.6977e-06,1.0659e-06,-8.4573e-08,-1.7748e-06,-5.5949e-07,-9.3801e-07,-2.4186e-06,1.5201e-06,-4.1867e-06,1.5271e-06,-1.7748e-06,-1.8349e-06,-3.5587e-07,-4.4236e-07,-6.6044e-06,1.4394e-06,1.5271e-06,-3.6859e-06,-3.3799e-06,2.1751e-06,-3.0501e-06,2.3055e-07,1.4394e-06,-3.9365e-07,-1.7333e-06,-3.2339e-06,-4.5127e-06,3.3721e-06,2.3055e-07,-4.4820e-06,-1.1255e-06,-3.6260e-06,-1.9030e-06,1.4934e-06,3.3721e-06,-1.3218e-06,-2.0266e-06,-1.1311e-06,-3.3111e-06,2.6343e-08,1.4934e-06,-1.1224e-06,-2.0698e-06,-1.0977e-06,-1.8725e-06,-1.3485e-07,2.6343e-08,-1.7999e-06,-1.3057e-06,-1.1853e-06,-1.4059e-06,-4.3926e-07,-1.3485e-07,-2.8183e-06,-2.3507e-06,-2.1823e-06,-3.1889e-07,1.9599e-06,-4.3926e-07,-2.7185e-06,-2.6966e-06,-1.9438e-06,2.9790e-07,-1.0485e-06,1.9599e-06,1.7676e-07,1.7590e-07,1.7676e-07,1.6933e-07,1.7707e-07,2.1857e-07,1.7707e-07,2.1171e-07,1.7711e-07,-1.6947e-06,1.7711e-07,-3.9251e-06,3.6431e-06,-3.6431e-06,1.0915e-05,-1.0915e-05,2.2749e-05,-2.2749e-05,-1.2794e-06,1.2794e-06,-4.6732e-06,4.6732e-06,-1.7620e-05,1.7620e-05}
pCurr      = {-8.9057e-06,9.3590e-05,-9.6166e-07,-1.0204e-04,7.2880e-05,1.1398e-04,-6.1465e-06,2.2816e-04,-1.6942e-04,-1.0826e-04,1.5132e-04,7.2880e-05,8.1083e-05,2.1993e-04,-1.2721e-04,-1.7681e-05,-1.2862e-04,1.5132e-04,1.5726e-04,1.3470e-05,3.8575e-05,2.1917e-04,-1.2103e-04,-1.2862e-04,3.1857e-04,2.2737e-04,-3.4235e-04,1.1362e-04,-1.7353e-05,-1.2103e-04,7.7312e-05,-3.6746e-04,3.0152e-04,4.6626e-04,-2.8144e-04,-1.7353e-05,4.2305e-04,3.2696e-05,3.1368e-04,-1.9070e-04,-1.1846e-04,-2.8144e-04,8.0540e-05,-1.9470e-05,6.6144e-05,1.5523e-04,1.4844e-05,-1.1846e-04,9.8783e-05,-5.4113e-05,9.2114e-05,-1.2434e-05,3.9633e-05,1.4844e-05,1.2754e-04,-4.7101e-05,5.5429e-05,-3.9685e-05,4.3013e-05,3.9633e-05,2.1561e-04,7.2426e-05,1.0579e-04,-1.0820e-04,-1.6010e-04,4.3013e-05,2.6082e-04,-5.1548e-05,1.3223e-04,-1.1783e-04,1.0498e-04,-1.6010e-04,-1.4996e-05,-1.4923e-05,-1.4996e-05,-1.4366e-05,-1.5022e-05,-1.8543e-05,-1.5022e-05,-1.7961e-05,-1.5025e-05,-2.3724e-04,-1.5025e-05,3.6083e-04,5.2958e-06,-5.2958e-06,9.8151e-06,-9.8151e-06,3.5423e-05,-3.5423e-05,-1.8083e-06,1.8083e-06,9.5082e-06,-9.5082e-06,6.9829e-05,-6.9829e-05}
grad*pCur  = -2.052373645045742E-8
parameters = {-2.3845e-01,-9.9002e-01,-6.0218e-01,-3.1292e-01,-6.0450e-01,-6.2040e-01,3.6681e-01,-4.4861e-01,-4.1335e-01,-4.6689e-01,-1.8019e+00,-6.0450e-01,1.7190e-01,1.1990e-01,-2.4491e+00,1.6035e+00,-1.0733e+00,-1.8019e+00,-2.7806e-01,5.6434e-01,-3.1324e+00,1.8047e+00,-1.3143e+00,-1.0733e+00,-2.9831e-03,-6.0133e-01,-2.5597e-01,1.5859e-01,-1.4131e+00,-1.3143e+00,-4.6838e-01,6.9375e-01,-1.3363e+00,-2.1762e-02,-8.8336e-01,-1.4131e+00,8.9240e-01,-3.8288e-01,-2.7439e+00,4.2624e-01,-7.3759e-01,-8.8336e-01,-5.0869e-01,-3.1559e-01,-1.0700e+00,-9.2710e-02,-7.0450e-01,-7.3759e-01,-5.8298e-01,-5.1555e-01,-8.4888e-01,-5.5029e-01,-2.2690e-01,-7.0450e-01,-1.5648e-01,-8.1838e-01,-7.4631e-01,-4.9855e-01,-9.8248e-01,-2.2690e-01,-4.3729e-01,-5.5763e-01,-2.1045e-01,-2.7308e-01,-9.0753e-01,-9.8248e-01,-7.5985e-01,-1.6962e-01,-5.6592e-01,-3.9530e-01,-5.7024e-01,-9.0753e-01,8.8382e-02,8.7950e-02,8.8382e-02,8.4666e-02,8.8536e-02,1.0929e-01,8.8536e-02,1.0586e-01,8.8555e-02,-1.9320e+00,8.8555e-02,-1.1716e+00,9.6673e-02,-9.6673e-02,-1.1053e-02,1.1053e-02,6.2145e-01,-6.2145e-01,6.3351e-01,-6.3351e-01,8.8927e-01,-8.8927e-01,1.0834e+00,-1.0834e+00}
|grad|/|x| = 5.45169393081166E-6
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.3845e-01,-9.9002e-01,-6.0218e-01,-3.1292e-01,-6.0450e-01,-6.2040e-01,3.6681e-01,-4.4861e-01,-4.1334e-01,-4.6689e-01,-1.8019e+00,-6.0450e-01,1.7190e-01,1.1990e-01,-2.4491e+00,1.6035e+00,-1.0733e+00,-1.8019e+00,-2.7806e-01,5.6434e-01,-3.1324e+00,1.8047e+00,-1.3143e+00,-1.0733e+00,-2.9873e-03,-6.0133e-01,-2.5597e-01,1.5858e-01,-1.4131e+00,-1.3143e+00,-4.6838e-01,6.9376e-01,-1.3363e+00,-2.1768e-02,-8.8336e-01,-1.4131e+00,8.9239e-01,-3.8288e-01,-2.7439e+00,4.2625e-01,-7.3759e-01,-8.8336e-01,-5.0869e-01,-3.1559e-01,-1.0700e+00,-9.2712e-02,-7.0450e-01,-7.3759e-01,-5.8298e-01,-5.1555e-01,-8.4888e-01,-5.5029e-01,-2.2690e-01,-7.0450e-01,-1.5648e-01,-8.1838e-01,-7.4631e-01,-4.9855e-01,-9.8248e-01,-2.2690e-01,-4.3729e-01,-5.5763e-01,-2.1045e-01,-2.7308e-01,-9.0753e-01,-9.8248e-01,-7.5985e-01,-1.6962e-01,-5.6592e-01,-3.9530e-01,-5.7025e-01,-9.0753e-01,8.8382e-02,8.7950e-02,8.8382e-02,8.4667e-02,8.8536e-02,1.0929e-01,8.8536e-02,1.0586e-01,8.8555e-02,-1.9320e+00,8.8555e-02,-1.1716e+00,9.6673e-02,-9.6673e-02,-1.1053e-02,1.1053e-02,6.2145e-01,-6.2145e-01,6.3351e-01,-6.3351e-01,8.8927e-01,-8.8927e-01,1.0834e+00,-1.0834e+00}
> Gradient:  {-1.7017e-06,-1.2487e-06,-8.4613e-07,-6.0433e-07,-5.5949e-07,-1.1892e-06,-2.0989e-06,-2.6977e-06,1.0659e-06,-8.4573e-08,-1.7748e-06,-5.5949e-07,-9.3801e-07,-2.4186e-06,1.5201e-06,-4.1867e-06,1.5271e-06,-1.7748e-06,-1.8349e-06,-3.5587e-07,-4.4236e-07,-6.6044e-06,1.4394e-06,1.5271e-06,-3.6859e-06,-3.3799e-06,2.1751e-06,-3.0501e-06,2.3055e-07,1.4394e-06,-3.9365e-07,-1.7333e-06,-3.2339e-06,-4.5127e-06,3.3721e-06,2.3055e-07,-4.4820e-06,-1.1255e-06,-3.6260e-06,-1.9030e-06,1.4934e-06,3.3721e-06,-1.3218e-06,-2.0266e-06,-1.1311e-06,-3.3111e-06,2.6343e-08,1.4934e-06,-1.1224e-06,-2.0698e-06,-1.0977e-06,-1.8725e-06,-1.3485e-07,2.6343e-08,-1.7999e-06,-1.3057e-06,-1.1853e-06,-1.4059e-06,-4.3926e-07,-1.3485e-07,-2.8183e-06,-2.3507e-06,-2.1823e-06,-3.1889e-07,1.9599e-06,-4.3926e-07,-2.7185e-06,-2.6966e-06,-1.9438e-06,2.9790e-07,-1.0485e-06,1.9599e-06,1.7676e-07,1.7590e-07,1.7676e-07,1.6933e-07,1.7707e-07,2.1857e-07,1.7707e-07,2.1171e-07,1.7711e-07,-1.6947e-06,1.7711e-07,-3.9251e-06,3.6431e-06,-3.6431e-06,1.0915e-05,-1.0915e-05,2.2749e-05,-2.2749e-05,-1.2794e-06,1.2794e-06,-4.6732e-06,4.6732e-06,-1.7620e-05,1.7620e-05}
>>>> Re-trying (2/3).
Starting Function Value: 3.652749224093967
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.652749219641091    0.000138465433160    2.890685136662826    0.000026385963623
         2            4    3.652749218059838    0.000070935043566    1.000000000000000    0.000025458030674
         3            5    3.652749208481890    0.001999090074105    1.000000000000000    0.000101926614355
         4            7    3.652749207033653    0.000148050499045    0.338905418309616    0.000060894464439
         5            8    3.652749200193965    0.000428192792705    1.000000000000000    0.000014812493264
         6            9    3.652749199417607    0.000061170212830    1.000000000000000    0.000015846440606
         7           10    3.652749175151326    0.002639025795917    1.000000000000000    0.000076211320754
         8           11    3.652749136298431    0.005092063887634    1.000000000000000    0.000133062256905
         9           12    3.652749060399019    0.013020777624671    1.000000000000000    0.000183941816540
        10           15    3.652749012163999    0.011471693861975    0.660000000000000    0.000212741990884
Gradient   = {-4.9622e-06,-9.3346e-07,-4.0159e-06,-4.0347e-06,-8.5314e-08,-1.1042e-06,-6.5303e-06,1.3192e-08,-3.2085e-06,-3.5698e-06,-1.7550e-06,-8.5314e-08,-2.0046e-06,-2.3544e-06,1.3477e-06,-1.1936e-05,1.4458e-06,-1.7550e-06,-2.3917e-06,-3.0285e-06,-4.8280e-07,-1.2137e-05,1.3376e-06,1.4458e-06,-2.5171e-06,-3.0312e-06,-4.7966e-06,-6.3781e-06,1.2911e-07,1.3376e-06,-9.9281e-07,-1.2219e-05,-2.9747e-06,-2.2932e-06,3.0943e-06,1.2911e-07,-3.9999e-06,-2.5160e-06,-3.4997e-06,-9.3861e-06,1.0510e-06,3.0943e-06,-3.9126e-06,-5.3667e-06,-1.9056e-06,-4.5064e-06,-6.1612e-07,1.0510e-06,-2.5891e-06,-5.1299e-06,-3.0571e-07,-5.8125e-06,-8.0305e-07,-6.1612e-07,-2.8457e-06,-4.5853e-06,-1.7732e-06,-4.6301e-06,-6.1906e-07,-8.0305e-07,-2.5352e-06,-5.6970e-06,-2.4923e-06,-5.2873e-06,1.4951e-06,-6.1906e-07,-1.5193e-06,-8.5725e-06,-1.2110e-06,-4.2067e-06,-1.1215e-06,1.4951e-06,1.7577e-07,1.7491e-07,1.7577e-07,1.6838e-07,1.7608e-07,2.1735e-07,1.7608e-07,2.1052e-07,1.7611e-07,-3.7528e-06,1.7611e-07,-1.0856e-05,-6.5693e-06,6.5693e-06,1.3897e-04,-1.3897e-04,-6.4234e-06,6.4234e-06,1.6282e-06,-1.6282e-06,-1.4058e-05,1.4058e-05,4.8596e-05,-4.8596e-05}
pCurr      = {-6.2934e-04,1.0211e-03,-6.3073e-04,-1.8345e-03,7.7949e-04,1.4875e-03,-1.4280e-03,2.4146e-03,-2.2185e-03,-1.6029e-03,2.2490e-03,7.7949e-04,3.3234e-04,2.9319e-03,-1.8878e-03,-1.3678e-03,-1.9108e-03,2.2490e-03,1.9650e-03,2.9864e-04,5.6970e-04,1.2172e-03,-1.7928e-03,-1.9108e-03,2.1337e-03,3.3051e-03,-3.1705e-03,1.1991e-04,-2.4859e-04,-1.7928e-03,-7.9970e-04,-1.6141e-03,4.0384e-03,3.1322e-03,-4.1614e-03,-2.4859e-04,7.4381e-04,1.1209e-03,4.6006e-03,-2.2294e-04,-1.7341e-03,-4.1614e-03,-4.3690e-04,5.0819e-04,9.9277e-04,9.1021e-04,1.0668e-04,-1.7341e-03,-5.1985e-04,5.2199e-04,4.9703e-04,-2.5079e-04,-8.2105e-06,1.0668e-04,-3.6689e-04,1.3902e-05,6.7315e-04,-5.5899e-04,5.9388e-04,-8.2105e-06,1.2935e-03,8.7406e-04,1.2132e-03,-1.3627e-03,-2.4183e-03,5.9388e-04,2.2783e-03,-3.2331e-04,1.1456e-03,-1.8047e-03,1.3161e-03,-2.4183e-03,-2.2333e-04,-2.2224e-04,-2.2333e-04,-2.1394e-04,-2.2372e-04,-2.7615e-04,-2.2372e-04,-2.6749e-04,-2.2377e-04,-3.8628e-04,-2.2377e-04,-8.9538e-05,1.2164e-05,-1.2164e-05,-2.0252e-04,2.0252e-04,7.3741e-05,-7.3741e-05,6.8010e-06,-6.8010e-06,9.9725e-05,-9.9725e-05,7.3760e-05,-7.3760e-05}
grad*pCur  = -1.128219629517323E-7
parameters = {-2.3989e-01,-9.8773e-01,-6.0361e-01,-3.1705e-01,-6.0275e-01,-6.1708e-01,3.6357e-01,-4.4315e-01,-4.1833e-01,-4.7052e-01,-1.7969e+00,-6.0275e-01,1.7264e-01,1.2645e-01,-2.4533e+00,1.6003e+00,-1.0776e+00,-1.7969e+00,-2.7369e-01,5.6497e-01,-3.1311e+00,1.8073e+00,-1.3183e+00,-1.0776e+00,1.8195e-03,-5.9395e-01,-2.6314e-01,1.5881e-01,-1.4136e+00,-1.3183e+00,-4.7015e-01,6.9000e-01,-1.3273e+00,-1.4729e-02,-8.9261e-01,-1.4136e+00,8.9411e-01,-3.8040e-01,-2.7337e+00,4.2562e-01,-7.4145e-01,-8.9261e-01,-5.0970e-01,-3.1450e-01,-1.0678e+00,-9.0678e-02,-7.0427e-01,-7.4145e-01,-5.8415e-01,-5.1443e-01,-8.4774e-01,-5.5092e-01,-2.2691e-01,-7.0427e-01,-1.5729e-01,-8.1840e-01,-7.4481e-01,-4.9984e-01,-9.8116e-01,-2.2691e-01,-4.3438e-01,-5.5573e-01,-2.0774e-01,-2.7619e-01,-9.1291e-01,-9.8116e-01,-7.5474e-01,-1.7042e-01,-5.6333e-01,-3.9939e-01,-5.6732e-01,-9.1291e-01,8.7886e-02,8.7456e-02,8.7886e-02,8.4191e-02,8.8039e-02,1.0867e-01,8.8039e-02,1.0526e-01,8.8057e-02,-1.9329e+00,8.8057e-02,-1.1718e+00,9.6651e-02,-9.6651e-02,-1.0782e-02,1.0782e-02,6.2138e-01,-6.2138e-01,6.3352e-01,-6.3352e-01,8.8933e-01,-8.8933e-01,1.0838e+00,-1.0838e+00}
|grad|/|x| = 2.4099900526556476E-5
>>>> Exception caugth. Parameters reverted.
> Parameter: {-2.3989e-01,-9.8773e-01,-6.0361e-01,-3.1705e-01,-6.0275e-01,-6.1708e-01,3.6357e-01,-4.4315e-01,-4.1833e-01,-4.7052e-01,-1.7969e+00,-6.0275e-01,1.7264e-01,1.2645e-01,-2.4533e+00,1.6003e+00,-1.0776e+00,-1.7969e+00,-2.7369e-01,5.6497e-01,-3.1311e+00,1.8073e+00,-1.3183e+00,-1.0776e+00,1.8195e-03,-5.9395e-01,-2.6314e-01,1.5881e-01,-1.4136e+00,-1.3183e+00,-4.7015e-01,6.9000e-01,-1.3273e+00,-1.4729e-02,-8.9261e-01,-1.4136e+00,8.9411e-01,-3.8040e-01,-2.7337e+00,4.2562e-01,-7.4145e-01,-8.9261e-01,-5.0970e-01,-3.1450e-01,-1.0678e+00,-9.0678e-02,-7.0427e-01,-7.4145e-01,-5.8415e-01,-5.1443e-01,-8.4774e-01,-5.5092e-01,-2.2691e-01,-7.0427e-01,-1.5729e-01,-8.1840e-01,-7.4481e-01,-4.9984e-01,-9.8116e-01,-2.2691e-01,-4.3438e-01,-5.5573e-01,-2.0774e-01,-2.7619e-01,-9.1291e-01,-9.8116e-01,-7.5474e-01,-1.7042e-01,-5.6333e-01,-3.9939e-01,-5.6732e-01,-9.1291e-01,8.7886e-02,8.7456e-02,8.7886e-02,8.4191e-02,8.8039e-02,1.0867e-01,8.8039e-02,1.0526e-01,8.8057e-02,-1.9329e+00,8.8057e-02,-1.1718e+00,9.6651e-02,-9.6651e-02,-1.0782e-02,1.0782e-02,6.2138e-01,-6.2138e-01,6.3352e-01,-6.3352e-01,8.8933e-01,-8.8933e-01,1.0838e+00,-1.0838e+00}
> Gradient:  {-4.9622e-06,-9.3346e-07,-4.0159e-06,-4.0347e-06,-8.5314e-08,-1.1042e-06,-6.5303e-06,1.3192e-08,-3.2085e-06,-3.5698e-06,-1.7550e-06,-8.5314e-08,-2.0046e-06,-2.3544e-06,1.3477e-06,-1.1936e-05,1.4458e-06,-1.7550e-06,-2.3917e-06,-3.0285e-06,-4.8280e-07,-1.2137e-05,1.3376e-06,1.4458e-06,-2.5171e-06,-3.0312e-06,-4.7966e-06,-6.3781e-06,1.2911e-07,1.3376e-06,-9.9281e-07,-1.2219e-05,-2.9747e-06,-2.2932e-06,3.0943e-06,1.2911e-07,-3.9999e-06,-2.5160e-06,-3.4997e-06,-9.3861e-06,1.0510e-06,3.0943e-06,-3.9126e-06,-5.3667e-06,-1.9056e-06,-4.5064e-06,-6.1612e-07,1.0510e-06,-2.5891e-06,-5.1299e-06,-3.0571e-07,-5.8125e-06,-8.0305e-07,-6.1612e-07,-2.8457e-06,-4.5853e-06,-1.7732e-06,-4.6301e-06,-6.1906e-07,-8.0305e-07,-2.5352e-06,-5.6970e-06,-2.4923e-06,-5.2873e-06,1.4951e-06,-6.1906e-07,-1.5193e-06,-8.5725e-06,-1.2110e-06,-4.2067e-06,-1.1215e-06,1.4951e-06,1.7577e-07,1.7491e-07,1.7577e-07,1.6838e-07,1.7608e-07,2.1735e-07,1.7608e-07,2.1052e-07,1.7611e-07,-3.7528e-06,1.7611e-07,-1.0856e-05,-6.5693e-06,6.5693e-06,1.3897e-04,-1.3897e-04,-6.4234e-06,6.4234e-06,1.6282e-06,-1.6282e-06,-1.4058e-05,1.4058e-05,4.8596e-05,-4.8596e-05}
>>>> Re-trying (3/3).
After: gradient norm = 2.127414090102813E-4
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0108,0.0108}

Count Table 2:
---------------
h:                 {0.6214,-0.6214}

Count Table 3:
---------------
h:                 {0.6335,-0.6335}

Count Table 4:
---------------
h:                 {0.8893,-0.8893}

Count Table 5:
---------------
h:                 {1.0838,-1.0838}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {-0.2399,-0.9877,-0.6036,-0.3171,-0.6027,-0.6171,0.3636,-0.4432,-0.4183,-0.4705,-1.7969,-0.6027,0.1726,0.1264,-2.4533,1.6003,-1.0776,-1.7969,-0.2737,0.5650,-3.1311,1.8073,-1.3183,-1.0776,0.0018,-0.5940,-0.2631,0.1588,-1.4136,-1.3183,-0.4702,0.6900,-1.3273,-0.0147,-0.8926,-1.4136,0.8941,-0.3804,-2.7337,0.4256,-0.7415,-0.8926,-0.5097,-0.3145,-1.0678,-0.0907,-0.7043,-0.7415,-0.5842,-0.5144,-0.8477,-0.5509,-0.2269,-0.7043,-0.1573,-0.8184,-0.7448,-0.4998,-0.9812,-0.2269,-0.4344,-0.5557,-0.2077,-0.2762,-0.9129,-0.9812,-0.7547,-0.1704,-0.5633,-0.3994,-0.5673,-0.9129}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0879,0.0875}
Activity(exp=1):   {0.0879,0.0842}
Activity(exp=2):   {0.0880,0.1087}
Activity(exp=3):   {0.0880,0.1053}
Activity(exp=4):   {0.0881,-1.9329}
Activity(exp=5):   {0.0881,-1.1718}

  The Likelihood DID improve.
Suggested variations:
key=12;5;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component3-2-variation2).
>>  Starting new optimization: component3-2-variation2. (2021-05-21 19:48:51.407).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[84,85]},{"h":[86,87]},{"h":[88,89]},{"h":[90,91]},{"h":[92,93]},{"h":[94,95]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71],"activity":[[72,73],[74,75],[76,77],[78,79],[80,81],[82,83]]}]}

Value and gradient before optimization:
=======================================
value         = 3.652103587431399
gradient      = {0.0007,0.0002,0.0005,0.0004,0.0001,0.0001,0.0007,0.0005,0.0004,0.0003,0.0000,0.0001,0.0005,0.0004,0.0000,0.0010,0.0000,0.0000,0.0003,0.0005,0.0000,0.0011,0.0000,0.0000,0.0006,0.0005,0.0003,0.0007,0.0000,0.0000,0.0004,0.0008,0.0001,0.0007,0.0000,0.0000,0.0008,0.0003,0.0000,0.0008,0.0000,0.0000,0.0004,0.0007,0.0002,0.0006,0.0000,0.0000,0.0003,0.0008,0.0002,0.0004,0.0001,0.0000,0.0007,0.0005,0.0002,0.0004,0.0000,0.0001,0.0005,0.0005,0.0006,0.0004,0.0000,0.0000,0.0003,0.0007,0.0006,0.0003,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0005,0.0000,0.0015,-0.0000,0.0000,0.0001,-0.0001,-0.0000,0.0000,0.0000,-0.0000,-0.0050,0.0050,-0.0068,0.0068}
gradient norm = 0.012625687062909023
Starting Function Value: 3.652103587431399
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.651918097866620    0.029257803293634    2.317323655168503    0.000784734074535
         2            4    3.651916697583697    0.001847316755902    1.000000000000000    0.000758842805233
         3            5    3.651888162424064    0.053067523346554    1.000000000000000    0.002334715946726
         4            6    3.651859404730820    0.075838709235584    1.000000000000000    0.002862439475713
         5            7    3.651807873299107    0.130044321879306    1.000000000000000    0.003511743688145
         6            8    3.651756467615163    0.250902668330570    1.000000000000000    0.003635441211734
         7            9    3.651697406072817    0.055004886078038    1.000000000000000    0.002446959454384
         8           10    3.651671925297403    0.051683626121630    1.000000000000000    0.001649680256342
         9           11    3.651659954561954    0.076182492053196    1.000000000000000    0.001325042188266
        10           12    3.651651017944554    0.061470391597053    1.000000000000000    0.001124066883218
        11           13    3.651644289266308    0.054136911399436    1.000000000000000    0.001404789764925
        12           14    3.651628527045427    0.109934154541147    1.000000000000000    0.002149304744649
        13           15    3.651608360896045    0.171824572116713    1.000000000000000    0.003982116892534
        14           16    3.651576962883544    0.082591371327866    1.000000000000000    0.002579948603972
        15           17    3.651550510809596    0.089952798675066    1.000000000000000    0.001236562491200
        16           18    3.651545895021733    0.033337805629075    1.000000000000000    0.001192156453904
        17           19    3.651542256146518    0.019184227035824    1.000000000000000    0.000956535639079
        18           20    3.651536662589825    0.019925017901828    1.000000000000000    0.001274365086241
        19           21    3.651521846509251    0.046441757968315    1.000000000000000    0.002270595282818
        20           22    3.651499335504675    0.109526618820738    1.000000000000000    0.002899415501123
        21           24    3.651491217855908    0.075973136474157    0.390607723800796    0.003368194622776
        22           25    3.651471346390158    0.145760459104203    1.000000000000000    0.001884977208571
        23           26    3.651462695648907    0.094864392321611    1.000000000000000    0.000504663050177
        24           27    3.651460849022163    0.065121182392626    1.000000000000000    0.000396739570379
        25           28    3.651458911644068    0.020271092782797    1.000000000000000    0.000522310252417
        26           29    3.651449720841148    0.115580497872958    1.000000000000000    0.001052425109250
        27           30    3.651434544278631    0.170226632107905    1.000000000000000    0.001372817602480
        28           31    3.651416450298261    0.220963396054425    1.000000000000000    0.000955839172120
        29           32    3.651407690421641    0.085866888187058    1.000000000000000    0.000730182301475
        30           33    3.651402772609175    0.051501066410017    1.000000000000000    0.000279187194203
        31           34    3.651400303772530    0.082051814085686    1.000000000000000    0.000440329545493
        32           35    3.651398438080976    0.019546442670038    1.000000000000000    0.000592890152265
        33           36    3.651394302057586    0.046149709263517    1.000000000000000    0.000730769791269
        34           37    3.651390678987139    0.078434926157508    1.000000000000000    0.000640448202944
        35           38    3.651387704747617    0.103971105920508    1.000000000000000    0.000311199750675
        36           39    3.651386473554625    0.078316221419483    1.000000000000000    0.000124724300279
        37           40    3.651385772336065    0.038678553449451    1.000000000000000    0.000219693861313
        38           42    3.651385447152150    0.001273277632640    0.035205928896344    0.000223309647812
        39           43    3.651384302090345    0.076340741666953    1.000000000000000    0.000437141260452
        40           44    3.651383198105844    0.034409386504518    1.000000000000000    0.000446285508057
        41           45    3.651380549695722    0.065269343119109    1.000000000000000    0.000247670016967
        42           46    3.651379622984773    0.050872092155892    1.000000000000000    0.000094175995537
        43           47    3.651379419156731    0.019239959615600    1.000000000000000    0.000142697237118
        44           48    3.651379142921571    0.015750730772824    1.000000000000000    0.000205121264788
        45           49    3.651378706400462    0.020829458705556    1.000000000000000    0.000190082800999
        46           50    3.651378002749347    0.052183494035812    1.000000000000000    0.000206324962388
        47           51    3.651377387779998    0.069027109351088    1.000000000000000    0.000074994556681
        48           52    3.651377099751585    0.047556689443319    1.000000000000000    0.000094546897597
        49           53    3.651376676979376    0.031296754823251    1.000000000000000    0.000167686126781
        50           55    3.651376648215905    0.001977508542873    0.040236614006501    0.000167721177335
        51           56    3.651375088447225    0.103138667148971    1.000000000000000    0.000151203754124
        52           57    3.651374206092517    0.070051954051776    1.000000000000000    0.000193045039810
        53           58    3.651373480353275    0.066987896085314    1.000000000000000    0.000134718000414
        54           59    3.651373106528415    0.029877036042415    1.000000000000000    0.000099603733275
        55           60    3.651372836351202    0.018726294222048    1.000000000000000    0.000086781871084
        56           61    3.651372609003736    0.018325175500491    1.000000000000000    0.000094352018935
        57           62    3.651372224935954    0.047503406302542    1.000000000000000    0.000096064050611
        58           63    3.651371750038201    0.069808925379764    1.000000000000000    0.000131049501058
        59           64    3.651371099239842    0.084123705377829    1.000000000000000    0.000195380846496
        60           65    3.651370207675847    0.118817149053385    1.000000000000000    0.000227554457595
        61           66    3.651369053803535    0.128506946787959    1.000000000000000    0.000231093583727
        62           67    3.651367235825687    0.206731624112243    1.000000000000000    0.000126767178099
        63           68    3.651365306347672    0.215931969652192    1.000000000000000    0.000165463109447
        64           69    3.651363787491911    0.108292151263355    1.000000000000000    0.000297959888594
        65           70    3.651361383396580    0.140028114367095    1.000000000000000    0.000395761515917
        66           71    3.651358764644177    0.199829751529158    1.000000000000000    0.000433736845671
        67           72    3.651353705954927    0.547005911892879    1.000000000000000    0.000496871522433
        68           73    3.651349360102331    0.165106170348825    1.000000000000000    0.000622429160916
        69           74    3.651346187475072    0.169730862853109    1.000000000000000    0.000172659332093
        70           75    3.651344627770266    0.042551112037507    1.000000000000000    0.000253013344160
        71           76    3.651344483023058    0.032144285487931    1.000000000000000    0.000191365364606
        72           77    3.651341987805632    0.117462393588700    1.000000000000000    0.000086631365834
        73           78    3.651341423100857    0.045628503172801    1.000000000000000    0.000142962341476
        74           79    3.651340908298796    0.032152700179117    1.000000000000000    0.000197558993168
        75           80    3.651339873987113    0.035696414446820    1.000000000000000    0.000193790538477
        76           81    3.651338347547222    0.089918971608577    1.000000000000000    0.000112357418084
        77           83    3.651338316162908    0.003758246345049    0.047022898698375    0.000108486137449
        78           84    3.651337643817542    0.051943563230935    1.000000000000000    0.000050112164647
        79           85    3.651337555138521    0.022198918173732    1.000000000000000    0.000047049368835
        80           86    3.651337386094463    0.022997714055953    1.000000000000000    0.000046473704183
        81           87    3.651337085107503    0.029563599781419    1.000000000000000    0.000048923057526
        82           88    3.651336904805636    0.025918168853569    1.000000000000000    0.000049177214248
        83           89    3.651336616458529    0.017285175823360    1.000000000000000    0.000023866342674
        84           90    3.651336042736743    0.009567062455456    1.000000000000000    0.000025469596120
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-6.1846e-01,-1.0160e+00,-6.8592e-01,-8.2845e-02,-6.8536e-01,-9.0818e-01,3.3682e-01,-8.2707e-01,-3.8095e-01,-7.9399e-01,-1.6462e+00,-6.8536e-01,-7.5421e-03,-3.4395e-01,-3.4796e+00,2.5846e+00,-1.1502e+00,-1.6462e+00,-4.4245e-01,-2.7064e-01,-3.2105e+00,2.4797e+00,-1.4488e+00,-1.1502e+00,1.8765e-02,-1.4477e+00,1.9364e-01,8.2029e-03,-1.3670e+00,-1.4488e+00,-6.8351e-01,9.0596e-01,-1.1887e+00,-8.5782e-01,-8.5175e-01,-1.3670e+00,6.9622e-01,-1.1971e+00,-1.0646e+00,-5.6359e-01,-1.0620e+00,-8.5175e-01,-7.4472e-01,-5.5836e-01,-1.0898e+00,1.2619e-01,-7.1415e-01,-1.0620e+00,-7.1515e-01,-4.9693e-01,-1.0438e+00,-9.0357e-01,-1.6928e-01,-7.1415e-01,-2.7764e-02,-1.1778e+00,-9.1387e-01,-6.9706e-01,-1.0570e+00,-1.6928e-01,-6.4612e-01,-7.7720e-01,-2.1772e-01,-2.9695e-01,-1.0017e+00,-1.0570e+00,-8.8437e-01,-1.8805e-01,-7.3882e-01,-5.8934e-01,-5.9446e-01,-1.0017e+00,6.7180e-02,6.6851e-02,6.7180e-02,6.4355e-02,6.7297e-02,8.3069e-02,6.7297e-02,8.0462e-02,6.7311e-02,-2.2438e+00,6.7311e-02,-1.5516e+00,9.6666e-02,-9.6666e-02,-1.1079e-02,1.1079e-02,6.2139e-01,-6.2139e-01,6.3351e-01,-6.3351e-01,8.8653e-01,-8.8653e-01,1.0686e+00,-1.0686e+00}
> Gradient:  {-4.6624e-06,-1.0986e-06,3.0945e-06,2.3903e-06,1.0642e-06,8.6503e-07,-3.9985e-06,6.1930e-06,-3.4888e-07,-3.4732e-07,-9.0950e-07,1.0642e-06,1.5666e-06,1.6310e-06,-2.2178e-06,1.9912e-06,-5.0072e-07,-9.0950e-07,1.7043e-07,-1.9054e-06,-3.7662e-07,4.3893e-06,-2.1619e-07,-5.0072e-07,9.5041e-07,6.0583e-08,-5.6027e-06,6.2447e-06,1.2402e-07,-2.1619e-07,1.7178e-06,-3.2783e-06,6.0438e-07,1.5935e-06,7.9940e-07,1.2402e-07,3.0512e-06,2.9376e-07,-1.5437e-08,-1.0664e-06,-1.5018e-06,7.9940e-07,-1.0624e-06,4.0333e-06,-2.5196e-07,1.6121e-06,-1.2685e-06,-1.5018e-06,4.9921e-06,-1.8179e-06,-6.9579e-07,-6.5047e-09,3.5732e-07,-1.2685e-06,1.8814e-06,-5.9548e-07,2.6294e-06,-4.3741e-06,1.6622e-06,3.5732e-07,-8.5526e-07,-1.8417e-06,7.8927e-07,1.8139e-06,8.4509e-08,1.6622e-06,-2.1188e-06,-7.5361e-07,1.8655e-06,-1.3147e-06,3.8900e-06,8.4509e-08,1.3436e-07,1.3370e-07,1.3436e-07,1.2871e-07,1.3459e-07,1.6614e-07,1.3459e-07,1.6092e-07,1.3462e-07,-2.2325e-06,1.3462e-07,4.2882e-06,2.8535e-06,-2.8535e-06,-1.4397e-06,1.4397e-06,-2.5506e-06,2.5506e-06,-2.0355e-06,2.0355e-06,-9.1192e-06,9.1192e-06,-6.0043e-06,6.0043e-06}
>>>> Re-trying (1/3).
Starting Function Value: 3.6513367980626743
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.651336796259395    0.000141166383142    5.545213779790268    0.000028864848712
         2            4    3.651336794236396    0.000106800349103    1.000000000000000    0.000028660082889
         3            6    3.651336731814859    0.006591701181540    0.372967383914085    0.000151716763228
         4            7    3.651336691580157    0.005286127984219    1.000000000000000    0.000036261682157
         5            8    3.651336689309108    0.000791453737933    1.000000000000000    0.000013747989994
         6            9    3.651336688671258    0.000126760980045    1.000000000000000    0.000013067702144
         7           10    3.651336684301887    0.000558810246114    1.000000000000000    0.000029198617082
         8           13    3.651336678340434    0.000771504693238    0.660000000000000    0.000044841619273
         9           14    3.651336661464081    0.003051307002249    1.000000000000000    0.000069059987821
        10           16    3.651336655796071    0.001733388557229    0.344840322964541    0.000083830289113
        11           17    3.651336644192511    0.002523707787279    1.000000000000000    0.000056311684315
        12           18    3.651336536125365    0.003134108352448    1.000000000000000    0.000024449718542
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-6.1413e-01,-1.0152e+00,-6.8721e-01,-8.4223e-02,-6.8657e-01,-9.0927e-01,3.3992e-01,-8.3404e-01,-3.7818e-01,-7.9307e-01,-1.6447e+00,-6.8657e-01,-1.0511e-02,-3.4693e-01,-3.4759e+00,2.5848e+00,-1.1493e+00,-1.6447e+00,-4.4272e-01,-2.6770e-01,-3.2098e+00,2.4755e+00,-1.4485e+00,-1.1493e+00,1.9611e-02,-1.4473e+00,1.9646e-01,4.3429e-03,-1.3672e+00,-1.4485e+00,-6.8404e-01,9.0937e-01,-1.1887e+00,-8.5907e-01,-8.5298e-01,-1.3672e+00,6.9576e-01,-1.1980e+00,-1.0640e+00,-5.6379e-01,-1.0596e+00,-8.5298e-01,-7.4378e-01,-5.6082e-01,-1.0903e+00,1.2385e-01,-7.1194e-01,-1.0596e+00,-7.2081e-01,-4.9453e-01,-1.0425e+00,-9.0418e-01,-1.6859e-01,-7.1194e-01,-2.6478e-02,-1.1780e+00,-9.1751e-01,-6.9229e-01,-1.0597e+00,-1.6859e-01,-6.4474e-01,-7.7548e-01,-2.1612e-01,-2.9886e-01,-1.0017e+00,-1.0597e+00,-8.8129e-01,-1.8755e-01,-7.3864e-01,-5.8698e-01,-6.0040e-01,-1.0017e+00,6.6952e-02,6.6625e-02,6.6952e-02,6.4137e-02,6.7069e-02,8.2788e-02,6.7069e-02,8.0189e-02,6.7083e-02,-2.2436e+00,6.7083e-02,-1.5523e+00,9.6666e-02,-9.6666e-02,-1.1077e-02,1.1077e-02,6.2140e-01,-6.2140e-01,6.3350e-01,-6.3350e-01,8.8663e-01,-8.8663e-01,1.0686e+00,-1.0686e+00}
> Gradient:  {3.1996e-06,7.1201e-07,-3.4174e-08,1.6583e-06,3.9660e-07,7.6985e-07,4.2917e-06,-1.5720e-07,2.6757e-06,3.8505e-07,-8.8963e-07,3.9660e-07,1.6414e-06,1.8697e-06,-2.1648e-06,6.6427e-06,-4.8907e-07,-8.8963e-07,5.9743e-07,-7.9123e-07,-3.7933e-07,7.8692e-06,-1.9659e-07,-4.8907e-07,3.6845e-06,3.9853e-07,2.6117e-06,4.9358e-08,6.2830e-08,-1.9659e-07,-9.8264e-08,5.8146e-06,-1.9739e-07,4.3722e-07,5.9133e-07,6.2830e-08,5.3306e-06,6.5216e-07,-3.4822e-07,1.5899e-06,-1.2054e-06,5.9133e-07,1.4883e-06,6.7103e-06,1.3616e-06,-1.2409e-06,-5.0351e-07,-1.2054e-06,-5.6893e-07,8.1807e-06,-4.1197e-07,1.2655e-07,-2.1245e-07,-5.0351e-07,5.2363e-06,1.8733e-07,-7.0806e-07,9.1621e-07,1.1910e-06,-2.1245e-07,2.6384e-07,4.1135e-08,6.5269e-06,-1.2042e-06,-1.1652e-07,1.1910e-06,-5.0953e-07,-1.2022e-06,5.7691e-06,1.0199e-07,2.6594e-06,-1.1652e-07,1.3390e-07,1.3325e-07,1.3390e-07,1.2827e-07,1.3414e-07,1.6558e-07,1.3414e-07,1.6038e-07,1.3417e-07,2.4536e-06,1.3417e-07,4.6501e-06,3.3493e-07,-3.3493e-07,-4.0097e-07,4.0097e-07,4.8617e-07,-4.8617e-07,-4.7075e-06,4.7075e-06,3.9541e-06,-3.9541e-06,1.8532e-06,-1.8532e-06}
>>>> Re-trying (2/3).
>>>> Exception caugth. Parameters reverted.
> Parameter: {-6.1413e-01,-1.0152e+00,-6.8721e-01,-8.4223e-02,-6.8657e-01,-9.0927e-01,3.3992e-01,-8.3404e-01,-3.7818e-01,-7.9307e-01,-1.6447e+00,-6.8657e-01,-1.0511e-02,-3.4693e-01,-3.4759e+00,2.5848e+00,-1.1493e+00,-1.6447e+00,-4.4272e-01,-2.6770e-01,-3.2098e+00,2.4755e+00,-1.4485e+00,-1.1493e+00,1.9611e-02,-1.4473e+00,1.9646e-01,4.3429e-03,-1.3672e+00,-1.4485e+00,-6.8404e-01,9.0937e-01,-1.1887e+00,-8.5907e-01,-8.5298e-01,-1.3672e+00,6.9576e-01,-1.1980e+00,-1.0640e+00,-5.6379e-01,-1.0596e+00,-8.5298e-01,-7.4378e-01,-5.6082e-01,-1.0903e+00,1.2385e-01,-7.1194e-01,-1.0596e+00,-7.2081e-01,-4.9453e-01,-1.0425e+00,-9.0418e-01,-1.6859e-01,-7.1194e-01,-2.6478e-02,-1.1780e+00,-9.1751e-01,-6.9229e-01,-1.0597e+00,-1.6859e-01,-6.4474e-01,-7.7548e-01,-2.1612e-01,-2.9886e-01,-1.0017e+00,-1.0597e+00,-8.8129e-01,-1.8755e-01,-7.3864e-01,-5.8698e-01,-6.0040e-01,-1.0017e+00,6.6952e-02,6.6625e-02,6.6952e-02,6.4137e-02,6.7069e-02,8.2788e-02,6.7069e-02,8.0189e-02,6.7083e-02,-2.2436e+00,6.7083e-02,-1.5523e+00,9.6666e-02,-9.6666e-02,-1.1077e-02,1.1077e-02,6.2140e-01,-6.2140e-01,6.3350e-01,-6.3350e-01,8.8663e-01,-8.8663e-01,1.0686e+00,-1.0686e+00}
> Gradient:  {3.1996e-06,7.1201e-07,-3.4167e-08,1.6584e-06,3.9660e-07,7.6985e-07,4.2918e-06,-1.5715e-07,2.6757e-06,3.8506e-07,-8.8963e-07,3.9660e-07,1.6414e-06,1.8697e-06,-2.1648e-06,6.6428e-06,-4.8907e-07,-8.8963e-07,5.9743e-07,-7.9122e-07,-3.7933e-07,7.8692e-06,-1.9659e-07,-4.8907e-07,3.6845e-06,3.9853e-07,2.6118e-06,4.9376e-08,6.2830e-08,-1.9659e-07,-9.8213e-08,5.8147e-06,-1.9738e-07,4.3722e-07,5.9133e-07,6.2830e-08,5.3306e-06,6.5217e-07,-3.4822e-07,1.5899e-06,-1.2054e-06,5.9133e-07,1.4883e-06,6.7103e-06,1.3616e-06,-1.2408e-06,-5.0351e-07,-1.2054e-06,-5.6888e-07,8.1807e-06,-4.1197e-07,1.2656e-07,-2.1245e-07,-5.0351e-07,5.2363e-06,1.8737e-07,-7.0806e-07,9.1622e-07,1.1910e-06,-2.1245e-07,2.6385e-07,4.1186e-08,6.5269e-06,-1.2042e-06,-1.1652e-07,1.1910e-06,-5.0953e-07,-1.2022e-06,5.7692e-06,1.0199e-07,2.6594e-06,-1.1652e-07,1.3390e-07,1.3325e-07,1.3390e-07,1.2827e-07,1.3414e-07,1.6558e-07,1.3414e-07,1.6038e-07,1.3417e-07,2.4536e-06,1.3417e-07,4.6501e-06,3.3493e-07,-3.3493e-07,-4.0097e-07,4.0097e-07,4.8617e-07,-4.8617e-07,-4.7075e-06,4.7075e-06,3.9541e-06,-3.9541e-06,1.8531e-06,-1.8531e-06}
>>>> Re-trying (3/3).
After: gradient norm = 2.4451891120349803E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0111,0.0111}

Count Table 2:
---------------
h:                 {0.6214,-0.6214}

Count Table 3:
---------------
h:                 {0.6335,-0.6335}

Count Table 4:
---------------
h:                 {0.8866,-0.8866}

Count Table 5:
---------------
h:                 {1.0686,-1.0686}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {-0.6141,-1.0152,-0.6872,-0.0842,-0.6866,-0.9093,0.3399,-0.8340,-0.3782,-0.7931,-1.6447,-0.6866,-0.0105,-0.3469,-3.4759,2.5848,-1.1493,-1.6447,-0.4427,-0.2677,-3.2098,2.4755,-1.4485,-1.1493,0.0196,-1.4473,0.1965,0.0043,-1.3672,-1.4485,-0.6840,0.9094,-1.1887,-0.8591,-0.8530,-1.3672,0.6958,-1.1980,-1.0640,-0.5638,-1.0596,-0.8530,-0.7438,-0.5608,-1.0903,0.1238,-0.7119,-1.0596,-0.7208,-0.4945,-1.0425,-0.9042,-0.1686,-0.7119,-0.0265,-1.1780,-0.9175,-0.6923,-1.0597,-0.1686,-0.6447,-0.7755,-0.2161,-0.2989,-1.0017,-1.0597,-0.8813,-0.1875,-0.7386,-0.5870,-0.6004,-1.0017}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0670,0.0666}
Activity(exp=1):   {0.0670,0.0641}
Activity(exp=2):   {0.0671,0.0828}
Activity(exp=3):   {0.0671,0.0802}
Activity(exp=4):   {0.0671,-2.2436}
Activity(exp=5):   {0.0671,-1.5523}

  The Likelihood DID improve.
Suggested variations:
key=12;6;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component3-2-variation3).
>>  Starting new optimization: component3-2-variation3. (2021-05-21 19:55:01.936).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[84,85]},{"h":[86,87]},{"h":[88,89]},{"h":[90,91]},{"h":[92,93]},{"h":[94,95]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71],"activity":[[72,73],[74,75],[76,77],[78,79],[80,81],[82,83]]}]}

Value and gradient before optimization:
=======================================
value         = 3.6512655402305305
gradient      = {0.0001,0.0000,0.0001,0.0000,0.0000,0.0000,0.0001,0.0000,0.0001,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0002,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0002,0.0000,-0.0000,0.0001,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0001,0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,0.0001,0.0000,0.0001,0.0000,0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0001,0.0000,0.0001,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0009,0.0009,-0.0012,0.0012}
gradient norm = 0.002145306525814227
Starting Function Value: 3.6512655402305305
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.651259855487898    0.005234745789328    2.440092232200511    0.000190799337055
Gradient   = {2.2366e-05,-1.4229e-05,-1.9980e-05,-4.7985e-05,-3.2117e-07,-2.2286e-06,-7.1771e-06,-3.0632e-05,-2.0921e-06,-2.1330e-05,-8.2499e-07,-3.2117e-07,7.0389e-06,-1.9338e-05,-2.0666e-06,-4.6781e-05,-4.9792e-07,-8.2499e-07,3.3121e-06,-4.7322e-06,-6.3966e-07,-5.9693e-05,-2.1849e-07,-4.9792e-07,-1.7268e-05,-1.3122e-05,5.0435e-06,-3.7163e-05,2.5926e-07,-2.1849e-07,-2.9552e-06,-1.9532e-05,-1.7413e-05,-2.2899e-05,7.0478e-08,2.5926e-07,-6.2576e-05,-8.4885e-06,-3.1569e-06,1.2460e-05,-7.7881e-07,7.0478e-08,-1.4482e-05,-3.0270e-05,-1.4458e-06,-1.3065e-05,-2.4280e-06,-7.7881e-07,-2.9058e-05,-2.1246e-05,-6.9603e-06,4.2717e-06,-7.0488e-06,-2.4280e-06,-3.2030e-05,-5.8072e-06,-2.0684e-05,2.4504e-06,6.5058e-07,-7.0488e-06,-1.0492e-05,-1.0314e-05,-3.5643e-05,-6.5235e-06,-5.6262e-08,6.5058e-07,-1.2065e-05,3.6767e-06,-5.3401e-05,-2.5490e-06,2.0170e-06,-5.6262e-08,1.3390e-07,1.3325e-07,1.3390e-07,1.2827e-07,1.3414e-07,1.6557e-07,1.3414e-07,1.6038e-07,1.3416e-07,-1.2733e-05,1.3416e-07,-4.9243e-05,-3.8774e-08,3.8774e-08,6.1571e-08,-6.1571e-08,-6.1672e-08,6.1672e-08,1.8148e-07,-1.8148e-07,1.3952e-05,-1.3952e-05,-5.5923e-05,5.5923e-05}
pCurr      = {-5.6895e-05,3.4882e-05,4.8411e-05,1.1856e-04,6.6001e-07,5.4347e-06,1.6087e-05,7.5803e-05,3.7562e-06,5.2684e-05,2.0602e-06,6.6001e-07,-1.8005e-05,4.8010e-05,5.1507e-06,1.1282e-04,1.2435e-06,2.0602e-06,-8.5758e-06,1.1548e-05,1.5691e-06,1.4496e-04,5.4031e-07,1.2435e-06,4.1831e-05,3.2444e-05,-1.4567e-05,9.1708e-05,-6.7569e-07,5.4031e-07,6.7570e-06,4.5701e-05,4.3027e-05,5.6708e-05,-2.3707e-07,-6.7569e-07,1.5363e-04,2.0564e-05,7.5836e-06,-3.2150e-05,1.8858e-06,-2.3707e-07,3.5578e-05,7.3709e-05,3.0610e-06,3.1119e-05,5.9281e-06,1.8858e-06,7.1871e-05,5.0928e-05,1.6791e-05,-1.1442e-05,1.7205e-05,5.9281e-06,7.7982e-05,1.3713e-05,5.1040e-05,-6.9734e-06,-1.6866e-06,1.7205e-05,2.5372e-05,2.4758e-05,8.7096e-05,1.5424e-05,8.8141e-08,-1.6866e-06,2.9608e-05,-1.0958e-05,1.3176e-04,5.7084e-06,-5.1507e-06,8.8141e-08,-3.3508e-07,-3.3344e-07,-3.3508e-07,-3.2099e-07,-3.3567e-07,-4.1433e-07,-3.3567e-07,-4.0133e-07,-3.3573e-07,3.0311e-05,-3.3573e-07,1.1973e-04,9.0108e-08,-9.0108e-08,-1.4564e-07,1.4564e-07,1.4423e-07,-1.4423e-07,-3.6072e-07,3.6072e-07,-1.8250e-05,1.8250e-05,1.6255e-04,-1.6255e-04}
grad*pCur  = -9.147345151959006E-8
parameters = {-6.1430e-01,-1.0153e+00,-6.8737e-01,-8.4298e-02,-6.8659e-01,-9.0928e-01,3.3970e-01,-8.3407e-01,-3.7836e-01,-7.9311e-01,-1.6447e+00,-6.8659e-01,-1.0577e-02,-3.4694e-01,-3.4759e+00,2.5844e+00,-1.1493e+00,-1.6447e+00,-4.4277e-01,-2.6772e-01,-3.2098e+00,2.4751e+00,-1.4485e+00,-1.1493e+00,1.9479e-02,-1.4474e+00,1.9620e-01,4.2708e-03,-1.3672e+00,-1.4485e+00,-6.8412e-01,9.0902e-01,-1.1887e+00,-8.5909e-01,-8.5299e-01,-1.3672e+00,6.9554e-01,-1.1980e+00,-1.0640e+00,-5.6394e-01,-1.0596e+00,-8.5299e-01,-7.4383e-01,-5.6101e-01,-1.0903e+00,1.2368e-01,-7.1195e-01,-1.0596e+00,-7.2084e-01,-4.9476e-01,-1.0426e+00,-9.0429e-01,-1.6863e-01,-7.1195e-01,-2.6675e-02,-1.1781e+00,-9.1755e-01,-6.9240e-01,-1.0597e+00,-1.6863e-01,-6.4482e-01,-7.7559e-01,-2.1629e-01,-2.9896e-01,-1.0017e+00,-1.0597e+00,-8.8134e-01,-1.8778e-01,-7.3875e-01,-5.8706e-01,-6.0042e-01,-1.0017e+00,6.6952e-02,6.6625e-02,6.6952e-02,6.4137e-02,6.7069e-02,8.2787e-02,6.7069e-02,8.0189e-02,6.7082e-02,-2.2437e+00,6.7082e-02,-1.5527e+00,9.6665e-02,-9.6665e-02,-1.1076e-02,1.1076e-02,6.2140e-01,-6.2140e-01,6.3352e-01,-6.3352e-01,8.8871e-01,-8.8871e-01,1.0716e+00,-1.0716e+00}
|grad|/|x| = 1.922513243473739E-5
>>>> Exception caugth. Parameters reverted.
> Parameter: {-6.1430e-01,-1.0153e+00,-6.8737e-01,-8.4298e-02,-6.8659e-01,-9.0928e-01,3.3970e-01,-8.3407e-01,-3.7836e-01,-7.9311e-01,-1.6447e+00,-6.8659e-01,-1.0577e-02,-3.4694e-01,-3.4759e+00,2.5844e+00,-1.1493e+00,-1.6447e+00,-4.4277e-01,-2.6772e-01,-3.2098e+00,2.4751e+00,-1.4485e+00,-1.1493e+00,1.9479e-02,-1.4474e+00,1.9620e-01,4.2705e-03,-1.3672e+00,-1.4485e+00,-6.8412e-01,9.0902e-01,-1.1887e+00,-8.5909e-01,-8.5299e-01,-1.3672e+00,6.9554e-01,-1.1980e+00,-1.0640e+00,-5.6394e-01,-1.0596e+00,-8.5299e-01,-7.4383e-01,-5.6101e-01,-1.0903e+00,1.2368e-01,-7.1195e-01,-1.0596e+00,-7.2084e-01,-4.9476e-01,-1.0426e+00,-9.0429e-01,-1.6863e-01,-7.1195e-01,-2.6675e-02,-1.1781e+00,-9.1755e-01,-6.9240e-01,-1.0597e+00,-1.6863e-01,-6.4483e-01,-7.7559e-01,-2.1629e-01,-2.9896e-01,-1.0017e+00,-1.0597e+00,-8.8134e-01,-1.8778e-01,-7.3875e-01,-5.8706e-01,-6.0042e-01,-1.0017e+00,6.6952e-02,6.6625e-02,6.6952e-02,6.4137e-02,6.7069e-02,8.2787e-02,6.7069e-02,8.0189e-02,6.7082e-02,-2.2437e+00,6.7082e-02,-1.5527e+00,9.6665e-02,-9.6665e-02,-1.1076e-02,1.1076e-02,6.2140e-01,-6.2140e-01,6.3352e-01,-6.3352e-01,8.8871e-01,-8.8871e-01,1.0716e+00,-1.0716e+00}
> Gradient:  {2.2366e-05,-1.4229e-05,-1.9980e-05,-4.7985e-05,-3.2117e-07,-2.2286e-06,-7.1771e-06,-3.0632e-05,-2.0921e-06,-2.1330e-05,-8.2499e-07,-3.2117e-07,7.0389e-06,-1.9338e-05,-2.0666e-06,-4.6781e-05,-4.9792e-07,-8.2499e-07,3.3121e-06,-4.7322e-06,-6.3966e-07,-5.9693e-05,-2.1849e-07,-4.9792e-07,-1.7268e-05,-1.3122e-05,5.0435e-06,-3.7163e-05,2.5926e-07,-2.1849e-07,-2.9552e-06,-1.9532e-05,-1.7413e-05,-2.2899e-05,7.0478e-08,2.5926e-07,-6.2576e-05,-8.4885e-06,-3.1569e-06,1.2460e-05,-7.7881e-07,7.0478e-08,-1.4482e-05,-3.0270e-05,-1.4458e-06,-1.3065e-05,-2.4280e-06,-7.7881e-07,-2.9058e-05,-2.1246e-05,-6.9603e-06,4.2717e-06,-7.0488e-06,-2.4280e-06,-3.2030e-05,-5.8072e-06,-2.0684e-05,2.4504e-06,6.5058e-07,-7.0488e-06,-1.0492e-05,-1.0314e-05,-3.5643e-05,-6.5235e-06,-5.6262e-08,6.5058e-07,-1.2065e-05,3.6767e-06,-5.3401e-05,-2.5490e-06,2.0170e-06,-5.6262e-08,1.3390e-07,1.3325e-07,1.3390e-07,1.2827e-07,1.3414e-07,1.6557e-07,1.3414e-07,1.6038e-07,1.3416e-07,-1.2733e-05,1.3416e-07,-4.9243e-05,-3.8774e-08,3.8774e-08,6.1571e-08,-6.1571e-08,-6.1672e-08,6.1672e-08,1.8148e-07,-1.8148e-07,1.3952e-05,-1.3952e-05,-5.5923e-05,5.5923e-05}
>>>> Re-trying (1/3).
Starting Function Value: 3.6512598554878983
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.651259537336596    0.003271966621342   17.148731603849864    0.000345476834943
         2            5    3.651259433065120    0.000646483152862    0.216352089785292    0.000301732280169
         3            6    3.651259042768589    0.004887344264385    1.000000000000000    0.000119146865535
         4            7    3.651258891970350    0.001514417102231    1.000000000000000    0.000142491571786
         5            8    3.651258395732486    0.009814006105181    1.000000000000000    0.000323648093862
         6            9    3.651251831122152    0.018613023993214    1.000000000000000    0.000453269536275
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-6.2522e-01,-1.0118e+00,-6.8437e-01,-7.3896e-02,-6.8672e-01,-9.0875e-01,3.3465e-01,-8.2463e-01,-3.8219e-01,-7.8747e-01,-1.6444e+00,-6.8672e-01,-1.3542e-02,-3.3959e-01,-3.4751e+00,2.5851e+00,-1.1491e+00,-1.6444e+00,-4.4418e-01,-2.6594e-01,-3.2096e+00,2.4806e+00,-1.4484e+00,-1.1491e+00,2.0783e-02,-1.4433e+00,1.8854e-01,1.2924e-02,-1.3672e+00,-1.4484e+00,-6.8476e-01,9.0305e-01,-1.1827e+00,-8.5208e-01,-8.5288e-01,-1.3672e+00,7.0386e-01,-1.1953e+00,-1.0629e+00,-5.7019e-01,-1.0592e+00,-8.5288e-01,-7.4055e-01,-5.5937e-01,-1.0908e+00,1.2445e-01,-7.1115e-01,-1.0592e+00,-7.1217e-01,-4.9673e-01,-1.0414e+00,-9.0802e-01,-1.6717e-01,-7.1115e-01,-2.5097e-02,-1.1777e+00,-9.1120e-01,-6.9553e-01,-1.0599e+00,-1.6717e-01,-6.4349e-01,-7.7391e-01,-2.1284e-01,-2.9878e-01,-1.0017e+00,-1.0599e+00,-8.7800e-01,-1.9383e-01,-7.2787e-01,-5.8791e-01,-6.0135e-01,-1.0017e+00,6.6902e-02,6.6575e-02,6.6902e-02,6.4090e-02,6.7019e-02,8.2726e-02,6.7019e-02,8.0129e-02,6.7033e-02,-2.2455e+00,6.7033e-02,-1.5447e+00,9.6655e-02,-9.6655e-02,-1.1052e-02,1.1052e-02,6.2138e-01,-6.2138e-01,6.3353e-01,-6.3353e-01,8.9009e-01,-8.9009e-01,1.0735e+00,-1.0735e+00}
> Gradient:  {2.0754e-05,-7.5931e-06,3.3062e-06,8.2485e-06,2.5233e-06,3.7720e-07,2.6928e-05,-1.4981e-05,1.9735e-05,-5.7730e-06,-8.1663e-07,2.5233e-06,6.7205e-06,-2.2999e-05,-2.1647e-06,4.7284e-05,-5.0096e-07,-8.1663e-07,3.8878e-06,-7.1739e-06,-9.3331e-07,3.2507e-05,-2.6255e-07,-5.0096e-07,1.5651e-05,-8.9626e-06,1.4611e-05,6.3984e-06,8.9215e-08,-2.6255e-07,1.0614e-05,4.0809e-05,-1.3436e-05,-1.0047e-05,-5.0435e-07,8.9215e-08,3.8683e-05,-1.1676e-05,-5.3564e-06,7.4808e-06,-1.1031e-06,-5.0435e-07,-1.7530e-06,2.6671e-05,-1.5661e-06,6.1996e-06,-9.2459e-07,-1.1031e-06,-1.2678e-05,3.0370e-05,-2.4328e-06,8.9006e-06,4.2889e-06,-9.2459e-07,3.2598e-05,-1.2277e-06,-1.6617e-05,7.7235e-06,7.5842e-07,4.2889e-06,3.4267e-06,-4.1439e-06,2.3596e-05,3.4780e-06,5.0039e-07,7.5842e-07,-4.7479e-06,1.1840e-05,8.5361e-06,7.4021e-06,4.0850e-06,5.0039e-07,1.3380e-07,1.3315e-07,1.3380e-07,1.2818e-07,1.3404e-07,1.6545e-07,1.3404e-07,1.6026e-07,1.3407e-07,-1.3330e-05,1.3407e-07,4.1347e-05,-4.5445e-06,4.5445e-06,1.1428e-05,-1.1428e-05,-7.0161e-06,7.0161e-06,7.1016e-06,-7.1016e-06,3.0405e-04,-3.0405e-04,-2.2323e-05,2.2323e-05}
>>>> Re-trying (2/3).
Starting Function Value: 3.6512574826445974
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.651257194261008    0.001208904596842    2.684420601130152    0.000158168488152
         2            4    3.651257127528956    0.000475646813605    1.000000000000000    0.000150722620915
Gradient   = {2.2353e-05,-4.2994e-06,8.7267e-06,1.0360e-05,2.0171e-06,-1.6661e-07,2.9719e-05,-1.1970e-05,2.4277e-05,-4.2269e-06,-8.2654e-07,2.0171e-06,8.0134e-06,-2.1133e-05,-2.0554e-06,5.5406e-05,-5.0624e-07,-8.2654e-07,4.8068e-06,-5.1963e-06,-7.6681e-07,4.0836e-05,-2.7531e-07,-5.0624e-07,1.7834e-05,-7.4128e-06,2.0546e-05,8.1711e-06,3.5556e-08,-2.7531e-07,1.1719e-05,4.7756e-05,-1.1239e-05,-8.7788e-06,-5.9526e-07,3.5556e-08,4.1883e-05,-8.7338e-06,-2.1823e-06,9.7755e-06,-1.2487e-06,-5.9526e-07,-7.5788e-07,3.2239e-05,4.2269e-07,9.6162e-06,-1.3734e-06,-1.2487e-06,-1.0372e-05,3.7142e-05,5.9559e-07,1.0310e-05,2.5967e-06,-1.3734e-06,3.6961e-05,2.1061e-06,-1.2783e-05,9.4377e-06,5.7936e-07,2.5967e-06,5.2064e-06,-1.3770e-06,2.9104e-05,5.1220e-06,3.5477e-07,5.7936e-07,-3.4886e-06,1.6810e-05,1.3139e-05,8.4501e-06,3.7241e-06,3.5477e-07,1.3380e-07,1.3315e-07,1.3380e-07,1.2818e-07,1.3404e-07,1.6545e-07,1.3404e-07,1.6026e-07,1.3406e-07,1.2511e-05,1.3406e-07,2.6880e-05,5.0039e-07,-5.0039e-07,-1.0873e-06,1.0873e-06,7.5109e-07,-7.5109e-07,-9.2272e-07,9.2272e-07,-2.6391e-05,2.6391e-05,2.7830e-05,-2.7830e-05}
pCurr      = {-8.2168e-04,2.1250e-04,-2.5142e-04,-3.0538e-04,-7.6297e-05,1.0244e-05,-1.0434e-03,5.1335e-04,-8.6373e-04,2.0548e-04,3.2538e-05,-7.6297e-05,-2.9898e-04,8.4438e-04,8.1694e-05,-1.9080e-03,1.9921e-05,3.2538e-05,-1.7862e-04,2.1737e-04,3.1094e-05,-1.3290e-03,1.0821e-05,1.9921e-05,-6.1842e-04,3.1213e-04,-6.8486e-04,-2.4666e-04,-1.4440e-06,1.0821e-05,-4.2926e-04,-1.6583e-03,4.6416e-04,3.7351e-04,2.2876e-05,-1.4440e-06,-1.4409e-03,3.7256e-04,1.0334e-04,-3.3564e-04,4.9351e-05,2.2876e-05,6.5402e-05,-1.1150e-03,1.2431e-05,-2.9673e-04,5.6139e-05,4.9351e-05,4.4925e-04,-1.2944e-03,1.3006e-05,-3.6213e-04,-9.0336e-05,5.6139e-05,-1.2971e-03,-3.7292e-05,5.4263e-04,-3.2441e-04,-2.1942e-05,-9.0336e-05,-1.5677e-04,1.0630e-04,-9.9005e-04,-1.5617e-04,-1.3422e-05,-2.1942e-05,1.6289e-04,-5.5819e-04,-3.8071e-04,-2.9826e-04,-1.4435e-04,-1.3422e-05,-5.2650e-06,-5.2393e-06,-5.2650e-06,-5.0437e-06,-5.2742e-06,-6.5103e-06,-5.2742e-06,-6.3060e-06,-5.2753e-06,-2.9909e-04,-5.2753e-06,-9.4873e-04,3.2444e-05,-3.2444e-05,-1.1039e-04,1.1039e-04,5.5611e-05,-5.5611e-05,-1.9374e-05,1.9374e-05,-5.4372e-04,5.4372e-04,-1.1544e-03,1.1544e-03}
grad*pCur  = -7.228214789014602E-7
parameters = {-6.2535e-01,-1.0117e+00,-6.8441e-01,-7.3955e-02,-6.8673e-01,-9.0875e-01,3.3448e-01,-8.2455e-01,-3.8232e-01,-7.8744e-01,-1.6443e+00,-6.8673e-01,-1.3585e-02,-3.3947e-01,-3.4751e+00,2.5848e+00,-1.1491e+00,-1.6443e+00,-4.4420e-01,-2.6591e-01,-3.2096e+00,2.4804e+00,-1.4484e+00,-1.1491e+00,2.0683e-02,-1.4432e+00,1.8844e-01,1.2878e-02,-1.3672e+00,-1.4484e+00,-6.8483e-01,9.0279e-01,-1.1827e+00,-8.5203e-01,-8.5287e-01,-1.3672e+00,7.0362e-01,-1.1953e+00,-1.0628e+00,-5.7024e-01,-1.0592e+00,-8.5287e-01,-7.4055e-01,-5.5954e-01,-1.0908e+00,1.2440e-01,-7.1115e-01,-1.0592e+00,-7.1211e-01,-4.9693e-01,-1.0414e+00,-9.0808e-01,-1.6720e-01,-7.1115e-01,-2.5304e-02,-1.1777e+00,-9.1111e-01,-6.9559e-01,-1.0599e+00,-1.6720e-01,-6.4352e-01,-7.7390e-01,-2.1299e-01,-2.9881e-01,-1.0017e+00,-1.0599e+00,-8.7797e-01,-1.9392e-01,-7.2794e-01,-5.8796e-01,-6.0137e-01,-1.0017e+00,6.6901e-02,6.6575e-02,6.6901e-02,6.4089e-02,6.7018e-02,8.2725e-02,6.7018e-02,8.0128e-02,6.7032e-02,-2.2455e+00,6.7032e-02,-1.5449e+00,9.6666e-02,-9.6666e-02,-1.1078e-02,1.1078e-02,6.2140e-01,-6.2140e-01,6.3351e-01,-6.3351e-01,8.8919e-01,-8.8919e-01,1.0736e+00,-1.0736e+00}
|grad|/|x| = 1.5201443241733012E-5
>>>> Exception caugth. Parameters reverted.
> Parameter: {-6.2535e-01,-1.0117e+00,-6.8441e-01,-7.3955e-02,-6.8673e-01,-9.0875e-01,3.3448e-01,-8.2455e-01,-3.8232e-01,-7.8744e-01,-1.6443e+00,-6.8673e-01,-1.3585e-02,-3.3947e-01,-3.4751e+00,2.5848e+00,-1.1491e+00,-1.6443e+00,-4.4420e-01,-2.6591e-01,-3.2096e+00,2.4804e+00,-1.4484e+00,-1.1491e+00,2.0683e-02,-1.4432e+00,1.8844e-01,1.2878e-02,-1.3672e+00,-1.4484e+00,-6.8483e-01,9.0279e-01,-1.1827e+00,-8.5203e-01,-8.5287e-01,-1.3672e+00,7.0362e-01,-1.1953e+00,-1.0628e+00,-5.7024e-01,-1.0592e+00,-8.5287e-01,-7.4055e-01,-5.5954e-01,-1.0908e+00,1.2440e-01,-7.1115e-01,-1.0592e+00,-7.1211e-01,-4.9693e-01,-1.0414e+00,-9.0808e-01,-1.6720e-01,-7.1115e-01,-2.5304e-02,-1.1777e+00,-9.1111e-01,-6.9559e-01,-1.0599e+00,-1.6720e-01,-6.4352e-01,-7.7390e-01,-2.1299e-01,-2.9881e-01,-1.0017e+00,-1.0599e+00,-8.7797e-01,-1.9392e-01,-7.2794e-01,-5.8796e-01,-6.0137e-01,-1.0017e+00,6.6901e-02,6.6575e-02,6.6901e-02,6.4089e-02,6.7018e-02,8.2725e-02,6.7018e-02,8.0128e-02,6.7032e-02,-2.2455e+00,6.7032e-02,-1.5449e+00,9.6666e-02,-9.6666e-02,-1.1078e-02,1.1078e-02,6.2140e-01,-6.2140e-01,6.3351e-01,-6.3351e-01,8.8919e-01,-8.8919e-01,1.0736e+00,-1.0736e+00}
> Gradient:  {2.2353e-05,-4.2994e-06,8.7267e-06,1.0360e-05,2.0171e-06,-1.6661e-07,2.9719e-05,-1.1970e-05,2.4277e-05,-4.2269e-06,-8.2654e-07,2.0171e-06,8.0134e-06,-2.1133e-05,-2.0554e-06,5.5406e-05,-5.0624e-07,-8.2654e-07,4.8068e-06,-5.1963e-06,-7.6681e-07,4.0836e-05,-2.7531e-07,-5.0624e-07,1.7834e-05,-7.4128e-06,2.0546e-05,8.1711e-06,3.5556e-08,-2.7531e-07,1.1719e-05,4.7756e-05,-1.1239e-05,-8.7788e-06,-5.9526e-07,3.5556e-08,4.1883e-05,-8.7338e-06,-2.1823e-06,9.7755e-06,-1.2487e-06,-5.9526e-07,-7.5788e-07,3.2239e-05,4.2269e-07,9.6162e-06,-1.3734e-06,-1.2487e-06,-1.0372e-05,3.7142e-05,5.9559e-07,1.0310e-05,2.5967e-06,-1.3734e-06,3.6961e-05,2.1061e-06,-1.2783e-05,9.4377e-06,5.7936e-07,2.5967e-06,5.2064e-06,-1.3770e-06,2.9104e-05,5.1220e-06,3.5477e-07,5.7936e-07,-3.4886e-06,1.6810e-05,1.3139e-05,8.4501e-06,3.7241e-06,3.5477e-07,1.3380e-07,1.3315e-07,1.3380e-07,1.2818e-07,1.3404e-07,1.6545e-07,1.3404e-07,1.6026e-07,1.3406e-07,1.2511e-05,1.3406e-07,2.6880e-05,5.0039e-07,-5.0039e-07,-1.0873e-06,1.0873e-06,7.5109e-07,-7.5109e-07,-9.2272e-07,9.2272e-07,-2.6391e-05,2.6391e-05,2.7830e-05,-2.7830e-05}
>>>> Re-trying (3/3).
After: gradient norm = 1.5071821472159295E-4
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0111,0.0111}

Count Table 2:
---------------
h:                 {0.6214,-0.6214}

Count Table 3:
---------------
h:                 {0.6335,-0.6335}

Count Table 4:
---------------
h:                 {0.8892,-0.8892}

Count Table 5:
---------------
h:                 {1.0736,-1.0736}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {-0.6253,-1.0117,-0.6844,-0.0740,-0.6867,-0.9087,0.3345,-0.8246,-0.3823,-0.7874,-1.6443,-0.6867,-0.0136,-0.3395,-3.4751,2.5848,-1.1491,-1.6443,-0.4442,-0.2659,-3.2096,2.4804,-1.4484,-1.1491,0.0207,-1.4432,0.1884,0.0129,-1.3672,-1.4484,-0.6848,0.9028,-1.1827,-0.8520,-0.8529,-1.3672,0.7036,-1.1953,-1.0628,-0.5702,-1.0592,-0.8529,-0.7405,-0.5595,-1.0908,0.1244,-0.7111,-1.0592,-0.7121,-0.4969,-1.0414,-0.9081,-0.1672,-0.7111,-0.0253,-1.1777,-0.9111,-0.6956,-1.0599,-0.1672,-0.6435,-0.7739,-0.2130,-0.2988,-1.0017,-1.0599,-0.8780,-0.1939,-0.7279,-0.5880,-0.6014,-1.0017}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0669,0.0666}
Activity(exp=1):   {0.0669,0.0641}
Activity(exp=2):   {0.0670,0.0827}
Activity(exp=3):   {0.0670,0.0801}
Activity(exp=4):   {0.0670,-2.2455}
Activity(exp=5):   {0.0670,-1.5449}

  The Likelihood DID improve.
Suggested variations:
key=12;7;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component3-2-variation4).
>>  Starting new optimization: component3-2-variation4. (2021-05-21 19:57:02.607).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[84,85]},{"h":[86,87]},{"h":[88,89]},{"h":[90,91]},{"h":[92,93]},{"h":[94,95]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71],"activity":[[72,73],[74,75],[76,77],[78,79],[80,81],[82,83]]}]}

Value and gradient before optimization:
=======================================
value         = 3.651134088800768
gradient      = {0.0001,0.0000,0.0000,0.0001,0.0000,0.0000,0.0001,0.0000,0.0001,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0002,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0002,0.0000,-0.0000,0.0001,-0.0000,0.0001,-0.0000,0.0000,0.0000,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0002,-0.0000,0.0000,0.0001,0.0000,0.0000,-0.0000,0.0001,0.0000,0.0001,0.0000,0.0000,0.0000,0.0001,-0.0000,0.0001,0.0000,0.0000,0.0001,0.0000,-0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0001,0.0001,0.0000,0.0000,0.0000,0.0001,0.0001,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0002,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0006,0.0006,-0.0014,0.0014}
gradient norm = 0.002200379925109879
Starting Function Value: 3.651134088800768
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.651128051638596    0.005433146734071    2.469185740184931    0.000275254521372
         2            4    3.651126819739094    0.000699748680332    1.000000000000000    0.000259662887964
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-6.2548e-01,-1.0118e+00,-6.8443e-01,-7.4027e-02,-6.8678e-01,-9.0873e-01,3.3430e-01,-8.2453e-01,-3.8253e-01,-7.8736e-01,-1.6443e+00,-6.8678e-01,-1.3710e-02,-3.3943e-01,-3.4751e+00,2.5846e+00,-1.1491e+00,-1.6443e+00,-4.4430e-01,-2.6592e-01,-3.2096e+00,2.4801e+00,-1.4484e+00,-1.1491e+00,2.0396e-02,-1.4432e+00,1.8812e-01,1.3102e-02,-1.3672e+00,-1.4484e+00,-6.8496e-01,9.0276e-01,-1.1827e+00,-8.5215e-01,-8.5288e-01,-1.3672e+00,7.0325e-01,-1.1950e+00,-1.0629e+00,-5.7045e-01,-1.0592e+00,-8.5288e-01,-7.4027e-01,-5.5985e-01,-1.0908e+00,1.2418e-01,-7.1115e-01,-1.0592e+00,-7.1218e-01,-4.9723e-01,-1.0411e+00,-9.0828e-01,-1.6721e-01,-7.1115e-01,-2.5623e-02,-1.1778e+00,-9.1081e-01,-6.9578e-01,-1.0600e+00,-1.6721e-01,-6.4363e-01,-7.7394e-01,-2.1301e-01,-2.9897e-01,-1.0018e+00,-1.0600e+00,-8.7790e-01,-1.9406e-01,-7.2815e-01,-5.8799e-01,-6.0139e-01,-1.0018e+00,6.6901e-02,6.6574e-02,6.6901e-02,6.4088e-02,6.7017e-02,8.2724e-02,6.7017e-02,8.0128e-02,6.7031e-02,-2.2456e+00,6.7031e-02,-1.5452e+00,9.6665e-02,-9.6665e-02,-1.1076e-02,1.1076e-02,6.2140e-01,-6.2140e-01,6.3351e-01,-6.3351e-01,8.9061e-01,-8.9061e-01,1.0772e+00,-1.0772e+00}
> Gradient:  {2.2686e-06,-5.6089e-06,-3.7816e-05,-2.8701e-05,3.9714e-06,-7.4135e-06,-1.5795e-05,-2.9477e-05,3.7848e-06,-3.4947e-05,-8.3778e-07,3.9714e-06,1.3998e-05,-1.8117e-05,-2.1494e-06,-6.5788e-05,-4.9728e-07,-8.3778e-07,1.1826e-05,-4.8732e-06,-8.4264e-08,-7.9611e-05,-1.5140e-07,-4.9728e-07,1.8348e-05,-2.2967e-05,1.2267e-05,-8.1204e-05,3.1549e-07,-1.5140e-07,9.6737e-06,-8.1865e-05,-8.5028e-06,8.0657e-06,-1.0781e-06,3.1549e-07,-3.9075e-06,-8.0438e-05,-1.8566e-06,1.5557e-05,-1.6681e-06,-1.0781e-06,-7.7728e-05,8.5789e-06,-1.7652e-06,2.6419e-06,-3.4511e-06,-1.6681e-06,-7.6276e-06,3.7631e-06,-7.7975e-05,2.1481e-05,-9.5816e-06,-3.4511e-06,6.8881e-06,-2.7339e-06,-8.5392e-05,1.7628e-05,-1.9950e-07,-9.5816e-06,-2.1713e-06,-2.0663e-05,-5.7442e-05,7.5302e-06,-3.5469e-07,-1.9950e-07,-3.4552e-05,-1.7359e-05,-7.7493e-06,-1.4830e-05,1.5446e-06,-3.5469e-07,1.3380e-07,1.3315e-07,1.3380e-07,1.2818e-07,1.3403e-07,1.6545e-07,1.3403e-07,1.6026e-07,1.3406e-07,-1.4365e-05,1.3406e-07,-5.8534e-05,-6.5396e-09,6.5396e-09,-1.2411e-08,1.2411e-08,2.3769e-09,-2.3769e-09,2.4853e-09,-2.4853e-09,-5.2650e-06,5.2650e-06,-9.8592e-06,9.8592e-06}
>>>> Re-trying (1/3).
Starting Function Value: 3.651127857561389
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            4    3.651125853890373    0.015062318025474   58.007435454229650    0.000780752881475
         2            5    3.651124435671179    0.014789484451095    1.000000000000000    0.000497586711321
         3            6    3.651123780842223    0.001549103429768    1.000000000000000    0.000380864236773
         4            7    3.651120211451752    0.016387007848763    1.000000000000000    0.000587717164475
         5            8    3.651116091740963    0.034821508958839    1.000000000000000    0.000950573059917
         6            9    3.651114061735524    0.056636053255864    1.000000000000000    0.001426132998378
         7           11    3.651112531074345    0.006462997985640    0.300677687860072    0.001029645095170
         8           12    3.651110758596965    0.008460097770236    1.000000000000000    0.000191756616076
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-6.3395e-01,-1.0122e+00,-6.6943e-01,-6.8688e-02,-6.9037e-01,-9.0388e-01,3.2702e-01,-8.0796e-01,-3.9538e-01,-7.6807e-01,-1.6437e+00,-6.9037e-01,-2.4469e-02,-3.2597e-01,-3.4735e+00,2.5921e+00,-1.1488e+00,-1.6437e+00,-4.5326e-01,-2.6205e-01,-3.2095e+00,2.4975e+00,-1.4482e+00,-1.1488e+00,-2.9560e-03,-1.4283e+00,1.6601e-01,5.6596e-02,-1.3674e+00,-1.4482e+00,-6.9439e-01,9.2639e-01,-1.1774e+00,-8.5971e-01,-8.5183e-01,-1.3674e+00,6.7554e-01,-1.1416e+00,-1.0612e+00,-5.8709e-01,-1.0581e+00,-8.5183e-01,-6.9295e-01,-5.8147e-01,-1.0925e+00,1.0991e-01,-7.0921e-01,-1.0581e+00,-7.1320e-01,-5.1551e-01,-9.9142e-01,-9.3031e-01,-1.6468e-01,-7.0921e-01,-4.8106e-02,-1.1803e+00,-8.5611e-01,-7.1512e-01,-1.0600e+00,-1.6468e-01,-6.4795e-01,-7.6601e-01,-1.9172e-01,-3.1125e-01,-1.0016e+00,-1.0600e+00,-8.5739e-01,-1.9676e-01,-7.3605e-01,-5.8357e-01,-6.0316e-01,-1.0016e+00,6.6804e-02,6.6478e-02,6.6804e-02,6.3996e-02,6.6921e-02,8.2605e-02,6.6921e-02,8.0012e-02,6.6935e-02,-2.2474e+00,6.6935e-02,-1.5308e+00,9.6665e-02,-9.6665e-02,-1.1078e-02,1.1078e-02,6.2140e-01,-6.2140e-01,6.3351e-01,-6.3351e-01,8.9158e-01,-8.9158e-01,1.0807e+00,-1.0807e+00}
> Gradient:  {-5.3240e-06,3.8837e-06,1.1688e-05,-1.3492e-05,6.1427e-06,-1.0373e-05,4.8545e-06,-9.5098e-06,5.7089e-06,-1.3806e-05,-8.6472e-07,6.1427e-06,4.5985e-06,-2.3111e-05,-2.7785e-06,1.5115e-05,-5.2477e-07,-8.6472e-07,8.3182e-06,-1.2055e-05,1.8798e-07,-3.2490e-06,-2.4296e-07,-5.2477e-07,5.0172e-06,-2.0933e-05,-4.3007e-06,1.2741e-05,1.5263e-07,-2.4296e-07,-1.0488e-05,3.2361e-05,-1.2507e-05,-1.4975e-05,-2.1099e-06,1.5263e-07,-4.9383e-06,-1.3370e-05,-5.4451e-06,1.8310e-05,-1.2298e-08,-2.1099e-06,2.2874e-06,-4.9738e-05,1.7947e-06,3.9019e-05,-9.1621e-07,-1.2298e-08,2.6706e-05,-7.1406e-05,-9.5589e-06,3.1682e-05,1.5927e-05,-9.1621e-07,-4.3501e-05,4.2145e-07,-8.1521e-06,2.7724e-05,1.4903e-08,1.5927e-05,-2.9693e-06,1.7071e-06,-3.2069e-05,2.6674e-05,-8.3221e-07,1.4903e-08,-2.3224e-07,3.1587e-05,-6.4453e-05,2.1909e-05,4.5480e-06,-8.3221e-07,1.3361e-07,1.3296e-07,1.3361e-07,1.2799e-07,1.3384e-07,1.6521e-07,1.3384e-07,1.6002e-07,1.3387e-07,-1.4035e-05,1.3387e-07,6.9614e-06,1.7956e-08,-1.7956e-08,-9.9871e-07,9.9871e-07,9.5970e-08,-9.5970e-08,-1.7614e-08,1.7614e-08,-7.1129e-05,7.1129e-05,-9.7453e-06,9.7453e-06}
>>>> Re-trying (2/3).
Starting Function Value: 3.6511107580874684
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.651110640529222    0.001810311774208    9.440674412996827    0.000313294990964
         2            4    3.651110345273100    0.001587658672412    1.000000000000000    0.000296913376166
         3            6    3.651109194045400    0.012877288629765    0.368013876592282    0.000701409395118
         4            7    3.651108166391914    0.018078938640821    1.000000000000000    0.000169835490955
         5            8    3.651108022206480    0.001765975392281    1.000000000000000    0.000131584970876
         6            9    3.651107756466117    0.003798492149593    1.000000000000000    0.000222654065871
         7           10    3.651107661109642    0.006304554278028    1.000000000000000    0.000339885641470
         8           11    3.651107506731369    0.001489002910400    1.000000000000000    0.000136489407007
         9           12    3.651107419115852    0.002746925500365    1.000000000000000    0.000124237371145
        10           13    3.651107269811038    0.004749604572190    1.000000000000000    0.000205104094510
        11           14    3.651106864090179    0.011904329851783    1.000000000000000    0.000369109437447
        12           15    3.651106038925091    0.023723650563395    1.000000000000000    0.000545130578181
        13           17    3.651105913533776    0.002698005293561    0.077557397813273    0.000546352837781
        14           19    3.651105715999025    0.007186747595158    0.070650736453637    0.000665566303023
        15           20    3.651104061925838    0.051220194742744    1.000000000000000    0.000297417181998
        16           21    3.651103827662521    0.003135158855780    1.000000000000000    0.000138259156594
        17           22    3.651103679438970    0.005346337943539    1.000000000000000    0.000126982663721
        18           23    3.651102263826123    0.001570341077477    1.000000000000000    0.000164928025932
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-6.2766e-01,-1.0165e+00,-6.6857e-01,-5.7530e-02,-7.0053e-01,-8.8901e-01,3.2297e-01,-7.9660e-01,-3.9902e-01,-7.4436e-01,-1.6423e+00,-7.0053e-01,-3.1384e-02,-2.8609e-01,-3.4689e+00,2.5710e+00,-1.1478e+00,-1.6423e+00,-4.6648e-01,-2.4103e-01,-3.2096e+00,2.5072e+00,-1.4478e+00,-1.1478e+00,-8.6328e-03,-1.3930e+00,1.6468e-01,4.6773e-02,-1.3675e+00,-1.4478e+00,-6.8317e-01,8.9291e-01,-1.1579e+00,-8.4098e-01,-8.4883e-01,-1.3675e+00,6.7693e-01,-1.1134e+00,-1.0552e+00,-6.0794e-01,-1.0571e+00,-8.4883e-01,-6.8119e-01,-5.7789e-01,-1.0855e+00,1.0109e-01,-7.0492e-01,-1.0571e+00,-7.3628e-01,-4.8486e-01,-9.5595e-01,-9.5441e-01,-1.6908e-01,-7.0492e-01,-4.8320e-02,-1.1696e+00,-8.2405e-01,-7.3605e-01,-1.0584e+00,-1.6908e-01,-6.3284e-01,-7.4246e-01,-2.0003e-01,-3.2666e-01,-9.9941e-01,-1.0584e+00,-8.4471e-01,-1.9183e-01,-7.1565e-01,-6.0033e-01,-6.0789e-01,-9.9941e-01,6.6571e-02,6.6246e-02,6.6571e-02,6.3773e-02,6.6687e-02,8.2317e-02,6.6687e-02,7.9733e-02,6.6701e-02,-2.2336e+00,6.6701e-02,-1.5267e+00,9.6678e-02,-9.6678e-02,-1.0904e-02,1.0904e-02,6.2136e-01,-6.2136e-01,6.3350e-01,-6.3350e-01,8.9346e-01,-8.9346e-01,1.0821e+00,-1.0821e+00}
> Gradient:  {-3.6660e-06,-7.6164e-06,-1.1002e-05,6.6563e-06,1.2288e-06,-7.3209e-06,-2.2622e-06,-7.6788e-06,-4.2861e-06,-7.9214e-06,-8.0072e-07,1.2288e-06,3.3338e-06,-2.2809e-05,-2.5952e-06,1.5946e-06,-5.3529e-07,-8.0072e-07,5.5761e-06,-1.4256e-05,-6.4931e-08,-1.2200e-05,-3.3119e-07,-5.3529e-07,-3.3401e-06,-1.6623e-05,1.1493e-05,-1.2966e-05,-4.4969e-08,-3.3119e-07,9.5102e-06,-2.4145e-05,-5.7890e-06,6.5637e-07,-1.9997e-06,-4.4969e-08,1.1931e-05,-1.1407e-05,-4.4837e-06,-1.3634e-05,-2.2192e-06,-1.9997e-06,7.7039e-06,-2.1395e-05,-5.5836e-06,4.6507e-06,-4.9683e-06,-2.2192e-06,-3.5848e-06,-1.8046e-06,-8.6649e-07,-6.3019e-06,-4.2857e-06,-4.9683e-06,-8.9318e-06,3.9335e-06,-4.2729e-06,-6.7415e-06,-1.5134e-06,-4.2857e-06,5.4385e-06,9.3717e-06,-2.8220e-05,-5.1375e-06,-1.6601e-06,-1.5134e-06,1.6710e-06,4.6837e-06,-1.6640e-05,-1.0016e-05,2.4122e-07,-1.6601e-06,1.3314e-07,1.3249e-07,1.3314e-07,1.2755e-07,1.3337e-07,1.6463e-07,1.3337e-07,1.5947e-07,1.3340e-07,-1.1274e-06,1.3340e-07,-2.0194e-05,6.0115e-06,-6.0115e-06,8.1365e-05,-8.1365e-05,-1.7968e-05,1.7968e-05,-7.1591e-06,7.1591e-06,1.5659e-05,-1.5659e-05,5.8768e-05,-5.8768e-05}
>>>> Re-trying (3/3).
After: gradient norm = 1.650683912392904E-4
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0109,0.0109}

Count Table 2:
---------------
h:                 {0.6214,-0.6214}

Count Table 3:
---------------
h:                 {0.6335,-0.6335}

Count Table 4:
---------------
h:                 {0.8935,-0.8935}

Count Table 5:
---------------
h:                 {1.0821,-1.0821}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {-0.6277,-1.0165,-0.6686,-0.0575,-0.7005,-0.8890,0.3230,-0.7966,-0.3990,-0.7444,-1.6423,-0.7005,-0.0314,-0.2861,-3.4689,2.5710,-1.1478,-1.6423,-0.4665,-0.2410,-3.2096,2.5072,-1.4478,-1.1478,-0.0086,-1.3930,0.1647,0.0468,-1.3675,-1.4478,-0.6832,0.8929,-1.1579,-0.8410,-0.8488,-1.3675,0.6769,-1.1134,-1.0552,-0.6079,-1.0571,-0.8488,-0.6812,-0.5779,-1.0855,0.1011,-0.7049,-1.0571,-0.7363,-0.4849,-0.9560,-0.9544,-0.1691,-0.7049,-0.0483,-1.1696,-0.8241,-0.7361,-1.0584,-0.1691,-0.6328,-0.7425,-0.2000,-0.3267,-0.9994,-1.0584,-0.8447,-0.1918,-0.7157,-0.6003,-0.6079,-0.9994}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0666,0.0662}
Activity(exp=1):   {0.0666,0.0638}
Activity(exp=2):   {0.0667,0.0823}
Activity(exp=3):   {0.0667,0.0797}
Activity(exp=4):   {0.0667,-2.2336}
Activity(exp=5):   {0.0667,-1.5267}

  The Likelihood DID improve.
Suggested variations:
key=12;8;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component3-2-variation5).
>>  Starting new optimization: component3-2-variation5. (2021-05-21 19:59:43.437).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[84,85]},{"h":[86,87]},{"h":[88,89]},{"h":[90,91]},{"h":[92,93]},{"h":[94,95]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71],"activity":[[72,73],[74,75],[76,77],[78,79],[80,81],[82,83]]}]}

Value and gradient before optimization:
=======================================
value         = 3.65094200079625
gradient      = {0.0001,0.0001,0.0001,0.0001,0.0000,0.0000,0.0001,0.0001,0.0001,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0002,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0002,0.0000,-0.0000,0.0001,-0.0001,0.0001,0.0001,0.0000,0.0000,0.0001,0.0001,0.0000,0.0001,0.0000,0.0000,0.0001,0.0001,0.0000,0.0001,0.0000,0.0000,0.0001,0.0001,-0.0000,0.0001,0.0000,0.0000,0.0001,0.0001,0.0000,0.0001,0.0000,0.0000,0.0001,0.0001,0.0000,0.0001,0.0000,0.0000,0.0000,0.0001,0.0001,0.0001,0.0000,0.0000,0.0001,0.0001,0.0000,0.0001,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0002,0.0000,-0.0000,0.0001,-0.0001,-0.0000,0.0000,-0.0000,0.0000,-0.0010,0.0010,-0.0017,0.0017}
gradient norm = 0.0028855431200560068
Starting Function Value: 3.65094200079625
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.650931808521735    0.006982966842494    2.419983535840756    0.000411823349261
Gradient   = {-2.1436e-05,-6.4698e-06,-6.6609e-05,-3.6206e-05,1.6747e-06,5.7289e-07,-1.3915e-05,-1.5334e-05,-4.0516e-05,-5.9582e-05,-8.0143e-07,1.6747e-06,1.6373e-05,-1.9039e-05,-2.7977e-06,-1.2182e-04,-4.7498e-07,-8.0143e-07,1.0818e-05,-2.2425e-05,7.6090e-07,-1.1692e-04,-3.2610e-07,-4.7498e-07,-1.1768e-05,-1.0731e-04,-2.1407e-05,1.1986e-05,2.5914e-07,-3.2610e-07,9.6492e-06,-1.5830e-04,-1.3910e-06,2.3183e-05,-1.9647e-06,2.5914e-07,-1.4115e-04,1.0297e-05,-5.3910e-06,1.1295e-05,-1.6482e-06,-1.9647e-06,2.9083e-05,-4.8292e-05,-9.7755e-05,-3.6630e-06,-6.2903e-06,-1.6482e-06,-2.4619e-06,-3.1261e-05,-7.6490e-05,3.9871e-06,-1.6049e-05,-6.2903e-06,-4.4458e-05,-1.0564e-05,-6.3691e-05,7.3732e-06,-1.1766e-06,-1.6049e-05,-6.5798e-05,-1.4210e-05,-4.2631e-05,-2.9762e-06,-1.6826e-06,-1.1766e-06,1.2147e-05,-3.3841e-05,-1.1537e-04,1.1258e-05,-9.8677e-07,-1.6826e-06,1.3314e-07,1.3249e-07,1.3314e-07,1.2754e-07,1.3337e-07,1.6463e-07,1.3337e-07,1.5947e-07,1.3340e-07,-6.8428e-05,1.3340e-07,-5.9647e-05,-5.9477e-07,5.9477e-07,-1.0795e-05,1.0795e-05,1.9559e-06,-1.9559e-06,2.0964e-07,-2.0964e-07,1.4924e-05,-1.4924e-05,-7.4417e-05,7.4417e-05}
pCurr      = {4.9705e-05,1.3287e-05,1.5943e-04,8.3873e-05,-4.7827e-06,-2.0708e-06,2.7538e-05,3.4574e-05,9.5145e-05,1.4500e-04,1.9674e-06,-4.7827e-06,-4.2120e-05,4.5539e-05,6.8564e-06,2.8625e-04,1.1665e-06,1.9674e-06,-2.7927e-05,5.4410e-05,-2.0076e-06,2.7324e-04,7.8093e-07,1.1665e-06,2.4290e-05,2.6351e-04,4.6423e-05,-3.4587e-05,-7.5725e-07,7.8093e-07,-2.6206e-05,3.8032e-04,1.3516e-06,-5.9640e-05,4.5978e-06,-7.5725e-07,3.3961e-04,-2.9329e-05,1.2229e-05,-3.1264e-05,3.8199e-06,4.5978e-06,-7.5620e-05,1.1333e-04,2.3943e-04,3.6997e-06,1.4998e-05,3.8199e-06,3.0862e-06,7.0485e-05,1.8525e-04,-1.2290e-05,3.8137e-05,1.4998e-05,1.0337e-04,2.3313e-05,1.5318e-04,-2.1026e-05,2.6836e-06,3.8137e-05,1.5954e-04,3.1316e-05,9.7954e-05,3.9856e-06,3.9592e-06,2.6836e-06,-3.2853e-05,7.7868e-05,2.7904e-04,-3.0624e-05,2.0452e-06,3.9592e-06,-3.3013e-07,-3.2851e-07,-3.3013e-07,-3.1625e-07,-3.3070e-07,-4.0821e-07,-3.3070e-07,-3.9540e-07,-3.3077e-07,1.6558e-04,-3.3077e-07,1.3287e-04,1.2614e-06,-1.2614e-06,2.4508e-05,-2.4508e-05,-4.2516e-06,4.2516e-06,-1.6311e-07,1.6311e-07,8.0227e-06,-8.0227e-06,2.7660e-04,-2.7660e-04}
grad*pCur  = -4.1380061184567553E-7
parameters = {-6.2778e-01,-1.0166e+00,-6.6869e-01,-5.7745e-02,-7.0056e-01,-8.8904e-01,3.2264e-01,-7.9673e-01,-3.9918e-01,-7.4434e-01,-1.6423e+00,-7.0056e-01,-3.1500e-02,-2.8612e-01,-3.4689e+00,2.5705e+00,-1.1478e+00,-1.6423e+00,-4.6656e-01,-2.4102e-01,-3.2096e+00,2.5067e+00,-1.4478e+00,-1.1478e+00,-8.8531e-03,-1.3929e+00,1.6439e-01,4.6492e-02,-1.3675e+00,-1.4478e+00,-6.8331e-01,8.9268e-01,-1.1580e+00,-8.4114e-01,-8.4884e-01,-1.3675e+00,6.7675e-01,-1.1136e+00,-1.0553e+00,-6.0813e-01,-1.0571e+00,-8.4884e-01,-6.8144e-01,-5.7811e-01,-1.0854e+00,1.0083e-01,-7.0493e-01,-1.0571e+00,-7.3642e-01,-4.8516e-01,-9.5597e-01,-9.5454e-01,-1.6912e-01,-7.0493e-01,-4.8572e-02,-1.1697e+00,-8.2412e-01,-7.3621e-01,-1.0584e+00,-1.6912e-01,-6.3285e-01,-7.4262e-01,-2.0033e-01,-3.2682e-01,-9.9941e-01,-1.0584e+00,-8.4488e-01,-1.9206e-01,-7.1572e-01,-6.0050e-01,-6.0790e-01,-9.9941e-01,6.6571e-02,6.6246e-02,6.6571e-02,6.3772e-02,6.6687e-02,8.2316e-02,6.6687e-02,7.9733e-02,6.6701e-02,-2.2337e+00,6.6701e-02,-1.5272e+00,9.6664e-02,-9.6664e-02,-1.1099e-02,1.1099e-02,6.2140e-01,-6.2140e-01,6.3352e-01,-6.3352e-01,8.9591e-01,-8.9591e-01,1.0862e+00,-1.0862e+00}
|grad|/|x| = 4.1468463506790366E-5
>>>> Exception caugth. Parameters reverted.
> Parameter: {-6.2778e-01,-1.0167e+00,-6.6870e-01,-5.7752e-02,-7.0056e-01,-8.8904e-01,3.2264e-01,-7.9673e-01,-3.9919e-01,-7.4435e-01,-1.6423e+00,-7.0056e-01,-3.1496e-02,-2.8612e-01,-3.4689e+00,2.5704e+00,-1.1478e+00,-1.6423e+00,-4.6656e-01,-2.4103e-01,-3.2096e+00,2.5067e+00,-1.4478e+00,-1.1478e+00,-8.8551e-03,-1.3929e+00,1.6439e-01,4.6495e-02,-1.3675e+00,-1.4478e+00,-6.8331e-01,8.9265e-01,-1.1580e+00,-8.4114e-01,-8.4884e-01,-1.3675e+00,6.7672e-01,-1.1136e+00,-1.0553e+00,-6.0813e-01,-1.0571e+00,-8.4884e-01,-6.8143e-01,-5.7812e-01,-1.0854e+00,1.0083e-01,-7.0494e-01,-1.0571e+00,-7.3642e-01,-4.8516e-01,-9.5599e-01,-9.5454e-01,-1.6912e-01,-7.0494e-01,-4.8581e-02,-1.1697e+00,-8.2413e-01,-7.3621e-01,-1.0584e+00,-1.6912e-01,-6.3286e-01,-7.4262e-01,-2.0034e-01,-3.2682e-01,-9.9941e-01,-1.0584e+00,-8.4487e-01,-1.9206e-01,-7.1574e-01,-6.0049e-01,-6.0790e-01,-9.9941e-01,6.6571e-02,6.6246e-02,6.6571e-02,6.3772e-02,6.6687e-02,8.2316e-02,6.6687e-02,7.9733e-02,6.6701e-02,-2.2337e+00,6.6701e-02,-1.5273e+00,9.6664e-02,-9.6664e-02,-1.1101e-02,1.1101e-02,6.2140e-01,-6.2140e-01,6.3352e-01,-6.3352e-01,8.9591e-01,-8.9591e-01,1.0862e+00,-1.0862e+00}
> Gradient:  {-2.1436e-05,-6.4698e-06,-6.6609e-05,-3.6206e-05,1.6747e-06,5.7289e-07,-1.3915e-05,-1.5334e-05,-4.0516e-05,-5.9582e-05,-8.0143e-07,1.6747e-06,1.6373e-05,-1.9039e-05,-2.7977e-06,-1.2182e-04,-4.7498e-07,-8.0143e-07,1.0818e-05,-2.2425e-05,7.6090e-07,-1.1692e-04,-3.2610e-07,-4.7498e-07,-1.1768e-05,-1.0731e-04,-2.1407e-05,1.1986e-05,2.5914e-07,-3.2610e-07,9.6492e-06,-1.5830e-04,-1.3910e-06,2.3183e-05,-1.9647e-06,2.5914e-07,-1.4115e-04,1.0297e-05,-5.3910e-06,1.1295e-05,-1.6482e-06,-1.9647e-06,2.9083e-05,-4.8292e-05,-9.7755e-05,-3.6630e-06,-6.2903e-06,-1.6482e-06,-2.4619e-06,-3.1261e-05,-7.6490e-05,3.9871e-06,-1.6049e-05,-6.2903e-06,-4.4458e-05,-1.0564e-05,-6.3691e-05,7.3732e-06,-1.1766e-06,-1.6049e-05,-6.5798e-05,-1.4210e-05,-4.2631e-05,-2.9762e-06,-1.6826e-06,-1.1766e-06,1.2147e-05,-3.3841e-05,-1.1537e-04,1.1258e-05,-9.8677e-07,-1.6826e-06,1.3314e-07,1.3249e-07,1.3314e-07,1.2754e-07,1.3337e-07,1.6463e-07,1.3337e-07,1.5947e-07,1.3340e-07,-6.8428e-05,1.3340e-07,-5.9647e-05,-5.9477e-07,5.9477e-07,-1.0795e-05,1.0795e-05,1.9559e-06,-1.9559e-06,2.0964e-07,-2.0964e-07,1.4924e-05,-1.4924e-05,-7.4417e-05,7.4417e-05}
>>>> Re-trying (1/3).
Starting Function Value: 3.650931915236339
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.650931248659294    0.019939140725198   48.416671658248340    0.001624817903168
         2            4    3.650927830734930    0.004254261077220    1.000000000000000    0.000331445748620
         3            5    3.650927656663220    0.000825091651061    1.000000000000000    0.000290148524272
         4            6    3.650925772651854    0.008688038247993    1.000000000000000    0.000475267832133
         5            7    3.650922081787540    0.023088325362521    1.000000000000000    0.000945008758252
         6            8    3.650915250955934    0.061297040948639    1.000000000000000    0.001451431394949
         7           10    3.650912440106119    0.028338361524822    0.290770951439609    0.001419669197237
         8           11    3.650908476735867    0.043545771160871    1.000000000000000    0.000807236647281
         9           13    3.650908250805732    0.001010433450695    0.100637725010877    0.000730176570185
        10           14    3.650906920886974    0.008808371816849    1.000000000000000    0.000183574791704
        11           15    3.650906820316564    0.000924573373163    1.000000000000000    0.000198862433652
        12           16    3.650905177141619    0.017766515876130    1.000000000000000    0.000464878382783
        13           17    3.650903883726501    0.026090196468287    1.000000000000000    0.000902159930450
        14           18    3.650902433949231    0.021524375923519    1.000000000000000    0.000528239452105
        15           19    3.650901601799315    0.021293103128030    1.000000000000000    0.000134719127850
        16           20    3.650901497697314    0.002930207674430    1.000000000000000    0.000144095922040
        17           21    3.650901322426090    0.004643035601564    1.000000000000000    0.000187287242449
        18           22    3.650900916968926    0.008622738565195    1.000000000000000    0.000299246048972
        19           23    3.650900105086492    0.019058490478400    1.000000000000000    0.000266664886076
        20           25    3.650899888042604    0.007798278520172    0.233159050776963    0.000466675337338
        21           26    3.650899487164674    0.009884461279780    1.000000000000000    0.000207338391267
        22           27    3.650899365221450    0.003727164664491    1.000000000000000    0.000103951888094
        23           28    3.650899317615196    0.001250537897312    1.000000000000000    0.000102362794581
        24           29    3.650899225662153    0.001901806273700    1.000000000000000    0.000139093723323
        25           30    3.650898798483381    0.010283211383942    1.000000000000000    0.000257507718687
        26           31    3.650898097486437    0.022407496300425    1.000000000000000    0.000342983722690
        27           32    3.650897154203610    0.037629217633259    1.000000000000000    0.000327280445840
        28           33    3.650896897506478    0.043873313037899    1.000000000000000    0.000746232864902
        29           34    3.650896070603502    0.008158088171217    1.000000000000000    0.000222372977289
        30           35    3.650895864549190    0.006454932195989    1.000000000000000    0.000152541383220
        31           36    3.650895375401421    0.014073422423350    1.000000000000000    0.000230963551729
        32           37    3.650894647950354    0.030674597403444    1.000000000000000    0.000324096575453
        33           38    3.650893595327623    0.053407036864910    1.000000000000000    0.000315487721791
        34           39    3.650891861300891    0.078926387595881    1.000000000000000    0.000253674074196
        35           40    3.650890688507531    0.072108433318802    1.000000000000000    0.000191318759790
        36           41    3.650890518379205    0.009658228575142    1.000000000000000    0.000150807164030
        37           42    3.650890517854102    0.003965041824300    1.000000000000000    0.000073727996629
        38           43    3.650890434781262    0.003124890994184    1.000000000000000    0.000050341610615
        39           44    3.650890412878745    0.002487287167484    1.000000000000000    0.000061761073410
        40           45    3.650890356960147    0.004743804166490    1.000000000000000    0.000090299480830
        41           46    3.650890250087196    0.009468072876947    1.000000000000000    0.000123696078259
Gradient   = {-4.6617e-06,1.5690e-06,4.2180e-06,3.6980e-07,-3.2665e-06,-5.3835e-06,-9.7829e-06,4.0877e-06,4.4756e-06,-2.0421e-06,-6.2674e-07,-3.2665e-06,-5.2450e-07,-2.0794e-06,-2.0445e-06,-1.6189e-06,-3.5017e-07,-6.2674e-07,5.9803e-06,-1.3620e-06,1.7434e-06,-1.3003e-05,-2.5323e-07,-3.5017e-07,-5.9138e-06,1.9470e-06,5.7407e-06,-8.3152e-06,-4.4974e-07,-2.5323e-07,-3.3455e-06,-3.1109e-06,4.0604e-06,-8.4228e-08,-4.3143e-06,-4.4974e-07,-3.1567e-06,-3.0990e-06,8.3955e-06,-4.2929e-06,-7.7691e-07,-4.3143e-06,3.5598e-06,-2.2465e-06,-7.2004e-07,-9.6850e-06,2.6245e-06,-7.7691e-07,1.1726e-06,-1.8371e-05,-7.4232e-07,3.6602e-06,4.4117e-06,2.6245e-06,-4.0233e-06,-2.9987e-06,-3.1594e-06,3.0627e-07,-1.7808e-06,4.4117e-06,-2.4467e-06,7.8772e-06,-1.1904e-05,1.7886e-06,-6.8943e-07,-1.7808e-06,-1.9587e-06,6.7866e-06,-1.0452e-05,-1.0009e-06,1.5908e-07,-6.8943e-07,1.3013e-07,1.2950e-07,1.3013e-07,1.2466e-07,1.3036e-07,1.6091e-07,1.3036e-07,1.5586e-07,1.3039e-07,-6.9464e-06,1.3039e-07,1.8153e-07,7.1167e-06,-7.1167e-06,5.0482e-05,-5.0482e-05,-1.9884e-05,1.9884e-05,3.0011e-05,-3.0011e-05,-3.7994e-05,3.7994e-05,-3.8008e-05,3.8008e-05}
pCurr      = {1.0713e-03,5.8493e-04,-2.0871e-04,-7.6847e-04,1.3723e-03,1.2023e-03,5.2966e-04,2.2211e-03,-4.8196e-04,-8.0512e-04,4.1773e-04,1.3723e-03,-2.0185e-03,6.9967e-03,1.4122e-03,-3.7492e-03,2.4873e-04,4.1773e-04,-4.3208e-03,7.5318e-03,-8.4818e-04,5.2996e-04,1.6607e-04,2.4873e-04,2.0429e-03,2.2858e-04,-1.3268e-03,2.0068e-03,1.9003e-04,1.6607e-04,1.4074e-03,-1.4557e-03,-8.1082e-05,5.6762e-04,2.6794e-03,1.9003e-04,-1.1434e-03,-8.3072e-04,8.4637e-04,5.1009e-04,1.2458e-03,2.6794e-03,-2.0127e-03,-4.0464e-04,1.0613e-03,2.9471e-03,4.7069e-04,1.2458e-03,3.1590e-04,8.5269e-04,2.2942e-03,-4.0512e-04,-2.2079e-04,4.7069e-04,6.8737e-04,1.3775e-03,1.3802e-03,-1.2150e-03,1.2983e-03,-2.2079e-04,1.4874e-03,-2.0347e-03,4.3197e-04,1.1073e-03,9.6335e-04,1.2983e-03,8.2030e-04,1.2080e-03,-6.5468e-04,4.1946e-04,4.9719e-04,9.6335e-04,-7.8655e-05,-7.8270e-05,-7.8655e-05,-7.5348e-05,-7.8792e-05,-9.7258e-05,-7.8792e-05,-9.4205e-05,-7.8808e-05,2.7490e-03,-7.8808e-05,2.6889e-04,-2.9105e-05,2.9105e-05,2.7119e-05,-2.7119e-05,-2.3385e-05,2.3385e-05,-2.4517e-05,2.4517e-05,2.0221e-04,-2.0221e-04,6.5082e-05,-6.5082e-05}
grad*pCur  = -2.4200015604122245E-7
parameters = {-5.9848e-01,-9.8140e-01,-6.2310e-01,-3.7502e-02,-7.0757e-01,-9.1137e-01,3.0021e-01,-7.8377e-01,-3.9564e-01,-6.3879e-01,-1.6339e+00,-7.0757e-01,-1.5556e-01,-8.5371e-02,-3.4396e+00,2.5529e+00,-1.1425e+00,-1.6339e+00,-5.7548e-01,1.6995e-02,-3.2226e+00,2.4640e+00,-1.4444e+00,-1.1425e+00,-2.8631e-02,-1.2080e+00,1.4673e-01,-2.8566e-03,-1.3669e+00,-1.4444e+00,-6.7012e-01,8.9713e-01,-1.1035e+00,-8.6139e-01,-7.9922e-01,-1.3669e+00,6.4470e-01,-1.1451e+00,-9.2620e-01,-6.5864e-01,-1.0196e+00,-7.9922e-01,-7.2252e-01,-5.7537e-01,-9.9903e-01,7.3953e-02,-6.6152e-01,-1.0196e+00,-7.2670e-01,-5.1640e-01,-8.8861e-01,-9.5942e-01,-1.5141e-01,-6.6152e-01,-5.8493e-02,-1.1546e+00,-7.7773e-01,-7.2801e-01,-1.0338e+00,-1.5141e-01,-5.8444e-01,-7.0650e-01,-2.0474e-01,-3.5431e-01,-9.7566e-01,-1.0338e+00,-8.7309e-01,-1.6766e-01,-6.3488e-01,-6.1331e-01,-5.9482e-01,-9.7566e-01,6.5066e-02,6.4748e-02,6.5066e-02,6.2331e-02,6.5179e-02,8.0456e-02,6.5179e-02,7.7930e-02,6.5193e-02,-2.1773e+00,6.5193e-02,-1.4871e+00,9.6681e-02,-9.6681e-02,-1.0969e-02,1.0969e-02,6.2135e-01,-6.2135e-01,6.3359e-01,-6.3359e-01,9.0370e-01,-9.0370e-01,1.0952e+00,-1.0952e+00}
|grad|/|x| = 1.2750829342885833E-5
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.9849e-01,-9.8140e-01,-6.2309e-01,-3.7494e-02,-7.0758e-01,-9.1138e-01,3.0021e-01,-7.8379e-01,-3.9564e-01,-6.3878e-01,-1.6339e+00,-7.0758e-01,-1.5554e-01,-8.5446e-02,-3.4396e+00,2.5529e+00,-1.1425e+00,-1.6339e+00,-5.7543e-01,1.6914e-02,-3.2226e+00,2.4639e+00,-1.4444e+00,-1.1425e+00,-2.8653e-02,-1.2080e+00,1.4674e-01,-2.8779e-03,-1.3669e+00,-1.4444e+00,-6.7014e-01,8.9714e-01,-1.1035e+00,-8.6140e-01,-7.9925e-01,-1.3669e+00,6.4471e-01,-1.1451e+00,-9.2621e-01,-6.5865e-01,-1.0196e+00,-7.9925e-01,-7.2250e-01,-5.7536e-01,-9.9904e-01,7.3922e-02,-6.6152e-01,-1.0196e+00,-7.2670e-01,-5.1640e-01,-8.8863e-01,-9.5942e-01,-1.5141e-01,-6.6152e-01,-5.8501e-02,-1.1547e+00,-7.7774e-01,-7.2800e-01,-1.0338e+00,-1.5141e-01,-5.8445e-01,-7.0648e-01,-2.0474e-01,-3.5432e-01,-9.7567e-01,-1.0338e+00,-8.7310e-01,-1.6768e-01,-6.3487e-01,-6.1331e-01,-5.9482e-01,-9.7567e-01,6.5067e-02,6.4749e-02,6.5067e-02,6.2331e-02,6.5180e-02,8.0457e-02,6.5180e-02,7.7931e-02,6.5194e-02,-2.1773e+00,6.5194e-02,-1.4871e+00,9.6681e-02,-9.6681e-02,-1.0970e-02,1.0970e-02,6.2135e-01,-6.2135e-01,6.3359e-01,-6.3359e-01,9.0370e-01,-9.0370e-01,1.0952e+00,-1.0952e+00}
> Gradient:  {-4.6617e-06,1.5690e-06,4.2180e-06,3.6980e-07,-3.2665e-06,-5.3835e-06,-9.7829e-06,4.0877e-06,4.4756e-06,-2.0421e-06,-6.2674e-07,-3.2665e-06,-5.2450e-07,-2.0794e-06,-2.0445e-06,-1.6189e-06,-3.5017e-07,-6.2674e-07,5.9803e-06,-1.3620e-06,1.7434e-06,-1.3003e-05,-2.5323e-07,-3.5017e-07,-5.9138e-06,1.9470e-06,5.7407e-06,-8.3152e-06,-4.4974e-07,-2.5323e-07,-3.3455e-06,-3.1109e-06,4.0604e-06,-8.4228e-08,-4.3143e-06,-4.4974e-07,-3.1567e-06,-3.0990e-06,8.3955e-06,-4.2929e-06,-7.7691e-07,-4.3143e-06,3.5598e-06,-2.2465e-06,-7.2004e-07,-9.6850e-06,2.6245e-06,-7.7691e-07,1.1726e-06,-1.8371e-05,-7.4232e-07,3.6602e-06,4.4117e-06,2.6245e-06,-4.0233e-06,-2.9987e-06,-3.1594e-06,3.0627e-07,-1.7808e-06,4.4117e-06,-2.4467e-06,7.8772e-06,-1.1904e-05,1.7886e-06,-6.8943e-07,-1.7808e-06,-1.9587e-06,6.7866e-06,-1.0452e-05,-1.0009e-06,1.5908e-07,-6.8943e-07,1.3013e-07,1.2950e-07,1.3013e-07,1.2466e-07,1.3036e-07,1.6091e-07,1.3036e-07,1.5586e-07,1.3039e-07,-6.9464e-06,1.3039e-07,1.8153e-07,7.1167e-06,-7.1167e-06,5.0482e-05,-5.0482e-05,-1.9884e-05,1.9884e-05,3.0011e-05,-3.0011e-05,-3.7994e-05,3.7994e-05,-3.8008e-05,3.8008e-05}
>>>> Re-trying (2/3).
Starting Function Value: 3.6508902500871963
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.650890228745986    0.000340086915932    2.749375087062767    0.000060008491267
         2            4    3.650890220701594    0.000154683377178    1.000000000000000    0.000057143458445
         3            6    3.650890205832007    0.000317145826700    0.080649819898896    0.000054853713712
         4            7    3.650890137145868    0.003237500611289    1.000000000000000    0.000069916388788
         5            8    3.650890108821856    0.000839291592326    1.000000000000000    0.000062115913328
         6            9    3.650890050278781    0.002484145727891    1.000000000000000    0.000127774340158
         7           10    3.650889957733305    0.005504850226675    1.000000000000000    0.000174359992600
         8           11    3.650889896056198    0.005794489031710    1.000000000000000    0.000148740562430
         9           12    3.650889788284992    0.004254454949237    1.000000000000000    0.000082154314736
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.9665e-01,-9.8264e-01,-6.2592e-01,-3.9952e-02,-7.0529e-01,-9.0773e-01,3.0321e-01,-7.8612e-01,-3.9864e-01,-6.3792e-01,-1.6334e+00,-7.0529e-01,-1.5495e-01,-8.3260e-02,-3.4382e+00,2.5493e+00,-1.1423e+00,-1.6334e+00,-5.7927e-01,1.8486e-02,-3.2237e+00,2.4683e+00,-1.4442e+00,-1.1423e+00,-2.6220e-02,-1.2091e+00,1.4231e-01,1.0159e-03,-1.3666e+00,-1.4442e+00,-6.6819e-01,8.9530e-01,-1.1058e+00,-8.6135e-01,-7.9614e-01,-1.3666e+00,6.4246e-01,-1.1425e+00,-9.3143e-01,-6.5621e-01,-1.0190e+00,-7.9614e-01,-7.2476e-01,-5.7748e-01,-9.9815e-01,7.9711e-02,-6.6312e-01,-1.0190e+00,-7.2736e-01,-5.0870e-01,-8.8764e-01,-9.6205e-01,-1.5390e-01,-6.6312e-01,-5.9772e-02,-1.1528e+00,-7.7510e-01,-7.2865e-01,-1.0325e+00,-1.5390e-01,-5.8325e-01,-7.1097e-01,-2.0079e-01,-3.5552e-01,-9.7513e-01,-1.0325e+00,-8.7152e-01,-1.7173e-01,-6.3209e-01,-6.1287e-01,-5.9485e-01,-9.7513e-01,6.4977e-02,6.4659e-02,6.4977e-02,6.2245e-02,6.5090e-02,8.0345e-02,6.5090e-02,7.7823e-02,6.5104e-02,-2.1743e+00,6.5104e-02,-1.4892e+00,9.6686e-02,-9.6686e-02,-1.1103e-02,1.1103e-02,6.2132e-01,-6.2132e-01,6.3353e-01,-6.3353e-01,9.0410e-01,-9.0410e-01,1.0952e+00,-1.0952e+00}
> Gradient:  {1.1965e-06,2.2862e-06,-4.1319e-06,-2.4708e-06,-2.6785e-06,-4.0086e-06,4.1241e-06,-9.5380e-07,-6.4534e-06,-3.2209e-06,-6.2465e-07,-2.6785e-06,-8.1506e-07,-2.8284e-06,-2.1075e-06,-3.1662e-06,-3.5439e-07,-6.2465e-07,4.8038e-06,-3.0084e-06,1.5865e-06,-1.2654e-05,-2.6971e-07,-3.5439e-07,-2.3294e-07,9.5369e-07,-8.2178e-06,-1.6320e-06,-4.9754e-07,-2.6971e-07,-1.5305e-06,-4.4249e-06,2.5127e-06,-2.2491e-06,-3.7068e-06,-4.9754e-07,-8.7512e-06,-1.9557e-06,6.4754e-06,-1.2147e-06,-7.4326e-07,-3.7068e-06,-3.5665e-06,2.5466e-06,-3.7566e-06,-5.0107e-06,6.3417e-07,-7.4326e-07,-3.6425e-06,3.7840e-06,-2.9557e-06,-2.7018e-06,-5.0144e-06,6.3417e-07,2.9307e-06,-1.2587e-06,-3.8897e-06,-1.0087e-06,-1.6555e-06,-5.0144e-06,-1.4186e-06,-6.4880e-06,3.2737e-06,-2.6358e-06,-8.8284e-07,-1.6555e-06,-2.9751e-06,-1.4211e-05,1.0056e-05,-1.0887e-06,-7.0544e-07,-8.8284e-07,1.2995e-07,1.2932e-07,1.2995e-07,1.2449e-07,1.3018e-07,1.6069e-07,1.3018e-07,1.5565e-07,1.3021e-07,-3.1267e-06,1.3021e-07,-6.2909e-06,9.5407e-06,-9.5407e-06,-1.2784e-05,1.2784e-05,-3.6780e-05,3.6780e-05,4.6203e-06,-4.6203e-06,2.9206e-05,-2.9206e-05,-1.6777e-05,1.6777e-05}
>>>> Re-trying (3/3).
After: gradient norm = 8.212211484841996E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0111,0.0111}

Count Table 2:
---------------
h:                 {0.6213,-0.6213}

Count Table 3:
---------------
h:                 {0.6335,-0.6335}

Count Table 4:
---------------
h:                 {0.9041,-0.9041}

Count Table 5:
---------------
h:                 {1.0952,-1.0952}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {-0.5967,-0.9826,-0.6259,-0.0400,-0.7053,-0.9077,0.3032,-0.7861,-0.3986,-0.6379,-1.6334,-0.7053,-0.1549,-0.0833,-3.4382,2.5493,-1.1423,-1.6334,-0.5793,0.0185,-3.2237,2.4683,-1.4442,-1.1423,-0.0262,-1.2091,0.1423,0.0010,-1.3666,-1.4442,-0.6682,0.8953,-1.1058,-0.8614,-0.7961,-1.3666,0.6425,-1.1425,-0.9314,-0.6562,-1.0190,-0.7961,-0.7248,-0.5775,-0.9982,0.0797,-0.6631,-1.0190,-0.7274,-0.5087,-0.8876,-0.9621,-0.1539,-0.6631,-0.0598,-1.1528,-0.7751,-0.7286,-1.0325,-0.1539,-0.5833,-0.7110,-0.2008,-0.3555,-0.9751,-1.0325,-0.8715,-0.1717,-0.6321,-0.6129,-0.5948,-0.9751}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0650,0.0647}
Activity(exp=1):   {0.0650,0.0622}
Activity(exp=2):   {0.0651,0.0803}
Activity(exp=3):   {0.0651,0.0778}
Activity(exp=4):   {0.0651,-2.1743}
Activity(exp=5):   {0.0651,-1.4892}

  The Likelihood DID improve.
Suggested variations:
key=12;9;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component3-2-variation6).
>>  Starting new optimization: component3-2-variation6. (2021-05-21 20:04:20.894).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[84,85]},{"h":[86,87]},{"h":[88,89]},{"h":[90,91]},{"h":[92,93]},{"h":[94,95]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71],"activity":[[72,73],[74,75],[76,77],[78,79],[80,81],[82,83]]}]}

Value and gradient before optimization:
=======================================
value         = 3.6508784083525825
gradient      = {0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0002,0.0002,-0.0003,0.0003}
gradient norm = 5.486836987608372E-4
Starting Function Value: 3.6508784083525825
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.650877924410059    0.001304569756406    2.377635346834594    0.000078220034700
         2            4    3.650877910496654    0.000190175910840    1.000000000000000    0.000072422878149
         3            5    3.650877744596529    0.002949857048217    1.000000000000000    0.000063743872033
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.9668e-01,-9.8254e-01,-6.2564e-01,-3.9547e-02,-7.0516e-01,-9.0755e-01,3.0326e-01,-7.8584e-01,-3.9823e-01,-6.3776e-01,-1.6334e+00,-7.0516e-01,-1.5497e-01,-8.3230e-02,-3.4381e+00,2.5503e+00,-1.1423e+00,-1.6334e+00,-5.7953e-01,1.9091e-02,-3.2238e+00,2.4690e+00,-1.4442e+00,-1.1423e+00,-2.6110e-02,-1.2088e+00,1.4284e-01,1.1111e-03,-1.3665e+00,-1.4442e+00,-6.6788e-01,8.9598e-01,-1.1060e+00,-8.6128e-01,-7.9597e-01,-1.3665e+00,6.4309e-01,-1.1424e+00,-9.3148e-01,-6.5597e-01,-1.0189e+00,-7.9597e-01,-7.2458e-01,-5.7747e-01,-9.9762e-01,8.0038e-02,-6.6314e-01,-1.0189e+00,-7.2720e-01,-5.0871e-01,-8.8715e-01,-9.6192e-01,-1.5358e-01,-6.6314e-01,-5.9267e-02,-1.1528e+00,-7.7487e-01,-7.2873e-01,-1.0324e+00,-1.5358e-01,-5.8331e-01,-7.1039e-01,-2.0061e-01,-3.5527e-01,-9.7509e-01,-1.0324e+00,-8.7124e-01,-1.7064e-01,-6.3253e-01,-6.1279e-01,-5.9484e-01,-9.7509e-01,6.4971e-02,6.4653e-02,6.4971e-02,6.2239e-02,6.5084e-02,8.0338e-02,6.5084e-02,7.7816e-02,6.5098e-02,-2.1741e+00,6.5098e-02,-1.4883e+00,9.6661e-02,-9.6661e-02,-1.1067e-02,1.1067e-02,6.2142e-01,-6.2142e-01,6.3351e-01,-6.3351e-01,9.0481e-01,-9.0481e-01,1.0967e+00,-1.0967e+00}
> Gradient:  {4.2020e-06,-1.0470e-06,-1.5375e-06,4.5509e-07,-2.8864e-06,-3.9146e-06,8.4799e-06,-5.2687e-06,-4.0216e-06,-3.9999e-07,-6.3167e-07,-2.8864e-06,1.8899e-07,-2.0263e-06,-2.0804e-06,9.2557e-08,-3.6075e-07,-6.3167e-07,5.2015e-06,-1.4353e-05,1.5352e-06,3.4466e-06,-2.8683e-07,-3.6075e-07,2.5718e-06,-5.8139e-06,-4.0310e-06,3.2959e-06,-5.5357e-07,-2.8683e-07,-5.1830e-06,1.8461e-06,3.7934e-06,-4.3727e-07,-4.2833e-06,-5.5357e-07,4.5240e-06,-1.3690e-06,1.6320e-07,-3.0670e-06,-7.8554e-07,-4.2833e-06,-1.1244e-06,8.1937e-06,-1.0044e-05,-1.4497e-06,3.9185e-07,-7.8554e-07,-1.1385e-06,8.8601e-06,-8.2234e-06,4.6365e-07,-5.1713e-06,3.9185e-07,-1.0612e-06,1.2879e-06,-3.1767e-06,4.7399e-06,-1.4362e-06,-5.1713e-06,4.2219e-06,-8.6217e-06,4.5679e-06,-2.5827e-06,-8.7763e-07,-1.4362e-06,-5.2108e-06,-1.4708e-05,1.6007e-05,9.5849e-08,-3.4526e-08,-8.7763e-07,1.2994e-07,1.2931e-07,1.2994e-07,1.2448e-07,1.3017e-07,1.6068e-07,1.3017e-07,1.5563e-07,1.3020e-07,3.4877e-06,1.3020e-07,-7.8266e-06,-1.8892e-06,1.8892e-06,4.4442e-06,-4.4442e-06,8.6733e-06,-8.6733e-06,-3.1887e-07,3.1887e-07,6.8838e-06,-6.8838e-06,3.2058e-05,-3.2058e-05}
>>>> Re-trying (1/3).
Starting Function Value: 3.6508777966274204
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.650877787443043    0.000277409511619    4.351932291306158    0.000056849312337
         2            4    3.650877779145744    0.000203956677799    1.000000000000000    0.000056337670522
         3            6    3.650877775937922    0.000079724866769    0.011654810469887    0.000055995247771
         4            7    3.650877672382546    0.006349046603486    1.000000000000000    0.000082418241255
Gradient   = {-4.6159e-06,-6.0540e-06,-8.4346e-06,-1.2086e-05,-2.5680e-06,-4.1321e-06,-1.1344e-05,-8.4874e-06,-9.8271e-06,-5.0397e-06,-6.2347e-07,-2.5680e-06,-9.8041e-07,-2.8084e-06,-2.1272e-06,-3.1090e-05,-3.4991e-07,-6.2347e-07,4.6366e-06,-1.5321e-05,1.5379e-06,-2.8216e-05,-2.6748e-07,-3.4991e-07,-7.6603e-06,-8.9140e-06,-1.3525e-05,-7.1629e-06,-4.4983e-07,-2.6748e-07,-7.5566e-06,-2.4799e-05,1.8482e-06,-2.8585e-06,-4.1637e-06,-4.4983e-07,-2.1806e-05,-3.7364e-06,-1.7125e-06,-5.9388e-06,-6.2188e-07,-4.1637e-06,-2.9237e-06,-1.9532e-05,-1.0644e-05,-4.9238e-06,6.6559e-07,-6.2188e-07,-3.2345e-06,-2.2501e-05,-8.8383e-06,-1.9234e-06,-2.1476e-06,6.6559e-07,-2.4965e-05,-4.1389e-06,-5.8802e-06,4.1648e-07,-1.2636e-06,-2.1476e-06,-2.2776e-06,-6.8127e-06,-2.2438e-05,-4.3421e-06,-7.5581e-07,-1.2636e-06,-5.8761e-06,-1.2993e-05,-1.6054e-05,-2.4103e-06,1.9889e-07,-7.5581e-07,1.2988e-07,1.2924e-07,1.2988e-07,1.2442e-07,1.3010e-07,1.6060e-07,1.3010e-07,1.5556e-07,1.3013e-07,-2.1681e-05,1.3013e-07,-1.5820e-05,1.5531e-05,-1.5531e-05,-1.1440e-04,1.1440e-04,-1.0723e-04,1.0723e-04,-1.3775e-06,1.3775e-06,1.1135e-04,-1.1135e-04,-1.4012e-06,1.4012e-06}
pCurr      = {-2.4204e-04,8.0255e-05,8.0162e-05,6.9251e-05,2.0235e-04,2.9068e-04,-4.3519e-04,3.5306e-04,2.6963e-04,4.3326e-05,4.7488e-05,2.0235e-04,-3.4323e-05,9.9332e-05,1.5646e-04,1.9150e-04,2.6996e-05,4.7488e-05,-4.1676e-04,1.0472e-03,-1.2118e-04,-6.9542e-05,2.0785e-05,2.6996e-05,-1.2066e-04,3.9728e-04,3.1647e-04,-1.6387e-04,3.7451e-05,2.0785e-05,3.8236e-04,4.7576e-05,-3.2209e-04,2.6425e-05,3.1572e-04,3.7451e-05,-8.2132e-05,3.5881e-05,-3.5752e-05,2.0340e-04,5.0323e-05,3.1572e-04,3.6099e-05,-2.5937e-04,6.6787e-04,4.0022e-05,-4.7492e-05,5.0323e-05,4.5856e-05,-2.6416e-04,4.8627e-04,-4.7298e-05,3.1427e-04,-4.7492e-05,3.7733e-04,-9.1410e-05,1.3659e-04,-3.5070e-04,1.0137e-04,3.1427e-04,-3.1019e-04,5.1313e-04,-2.8772e-05,1.4522e-04,5.9910e-05,1.0137e-04,3.3854e-04,9.2861e-04,-8.1279e-04,-2.4363e-05,-9.2563e-06,5.9910e-05,-9.8962e-06,-9.8479e-06,-9.8962e-06,-9.4802e-06,-9.9135e-06,-1.2237e-05,-9.9135e-06,-1.1853e-05,-9.9156e-06,-5.3967e-05,-9.9156e-06,5.0496e-04,4.3854e-05,-4.3854e-05,-2.8696e-04,2.8696e-04,-2.8867e-04,2.8867e-04,-3.3741e-06,3.3741e-06,3.2189e-04,-3.2189e-04,1.5839e-04,-1.5839e-04}
grad*pCur  = 1.3756353154946325E-7
parameters = {-5.9773e-01,-9.8239e-01,-6.2552e-01,-3.9715e-02,-7.0450e-01,-9.0663e-01,3.0124e-01,-7.8475e-01,-3.9748e-01,-6.3775e-01,-1.6332e+00,-7.0450e-01,-1.5509e-01,-8.2886e-02,-3.4376e+00,2.5500e+00,-1.1422e+00,-1.6332e+00,-5.8088e-01,2.2503e-02,-3.2242e+00,2.4679e+00,-1.4441e+00,-1.1422e+00,-2.6805e-02,-1.2076e+00,1.4363e-01,2.5895e-04,-1.3664e+00,-1.4441e+00,-6.6671e-01,8.9537e-01,-1.1071e+00,-8.6126e-01,-7.9494e-01,-1.3664e+00,6.4199e-01,-1.1423e+00,-9.3160e-01,-6.5537e-01,-1.0188e+00,-7.9494e-01,-7.2450e-01,-5.7915e-01,-9.9542e-01,8.0098e-02,-6.6329e-01,-1.0188e+00,-7.2709e-01,-5.1050e-01,-8.8552e-01,-9.6214e-01,-1.5249e-01,-6.6329e-01,-5.8785e-02,-1.1532e+00,-7.7444e-01,-7.2998e-01,-1.0321e+00,-1.5249e-01,-5.8449e-01,-7.0862e-01,-2.0151e-01,-3.5485e-01,-9.7489e-01,-1.0321e+00,-8.7014e-01,-1.6750e-01,-6.3613e-01,-6.1294e-01,-5.9487e-01,-9.7489e-01,6.4939e-02,6.4621e-02,6.4939e-02,6.2209e-02,6.5052e-02,8.0298e-02,6.5052e-02,7.7778e-02,6.5065e-02,-2.1746e+00,6.5065e-02,-1.4872e+00,9.6699e-02,-9.6699e-02,-1.1318e-02,1.1318e-02,6.2116e-01,-6.2116e-01,6.3351e-01,-6.3351e-01,9.0488e-01,-9.0488e-01,1.0964e+00,-1.0964e+00}
|grad|/|x| = 2.95607823083296E-5
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.9748e-01,-9.8247e-01,-6.2560e-01,-3.9784e-02,-7.0470e-01,-9.0692e-01,3.0168e-01,-7.8510e-01,-3.9775e-01,-6.3780e-01,-1.6333e+00,-7.0470e-01,-1.5506e-01,-8.2986e-02,-3.4377e+00,2.5498e+00,-1.1422e+00,-1.6333e+00,-5.8046e-01,2.1456e-02,-3.2241e+00,2.4679e+00,-1.4441e+00,-1.1422e+00,-2.6684e-02,-1.2080e+00,1.4331e-01,4.2283e-04,-1.3665e+00,-1.4441e+00,-6.6709e-01,8.9532e-01,-1.1068e+00,-8.6128e-01,-7.9526e-01,-1.3665e+00,6.4207e-01,-1.1424e+00,-9.3156e-01,-6.5558e-01,-1.0188e+00,-7.9526e-01,-7.2454e-01,-5.7889e-01,-9.9609e-01,8.0058e-02,-6.6324e-01,-1.0188e+00,-7.2714e-01,-5.1024e-01,-8.8600e-01,-9.6209e-01,-1.5281e-01,-6.6324e-01,-5.9162e-02,-1.1531e+00,-7.7457e-01,-7.2963e-01,-1.0322e+00,-1.5281e-01,-5.8418e-01,-7.0913e-01,-2.0149e-01,-3.5499e-01,-9.7495e-01,-1.0322e+00,-8.7048e-01,-1.6843e-01,-6.3532e-01,-6.1291e-01,-5.9486e-01,-9.7495e-01,6.4948e-02,6.4631e-02,6.4948e-02,6.2218e-02,6.5062e-02,8.0310e-02,6.5062e-02,7.7789e-02,6.5075e-02,-2.1746e+00,6.5075e-02,-1.4877e+00,9.6655e-02,-9.6655e-02,-1.1031e-02,1.1031e-02,6.2145e-01,-6.2145e-01,6.3351e-01,-6.3351e-01,9.0456e-01,-9.0456e-01,1.0963e+00,-1.0963e+00}
> Gradient:  {-4.6159e-06,-6.0540e-06,-8.4346e-06,-1.2086e-05,-2.5680e-06,-4.1321e-06,-1.1344e-05,-8.4874e-06,-9.8271e-06,-5.0397e-06,-6.2347e-07,-2.5680e-06,-9.8041e-07,-2.8084e-06,-2.1272e-06,-3.1090e-05,-3.4991e-07,-6.2347e-07,4.6366e-06,-1.5321e-05,1.5379e-06,-2.8216e-05,-2.6748e-07,-3.4991e-07,-7.6603e-06,-8.9140e-06,-1.3525e-05,-7.1629e-06,-4.4983e-07,-2.6748e-07,-7.5566e-06,-2.4799e-05,1.8482e-06,-2.8585e-06,-4.1637e-06,-4.4983e-07,-2.1806e-05,-3.7364e-06,-1.7125e-06,-5.9388e-06,-6.2188e-07,-4.1637e-06,-2.9237e-06,-1.9532e-05,-1.0644e-05,-4.9238e-06,6.6559e-07,-6.2188e-07,-3.2345e-06,-2.2501e-05,-8.8383e-06,-1.9234e-06,-2.1476e-06,6.6559e-07,-2.4965e-05,-4.1389e-06,-5.8802e-06,4.1648e-07,-1.2636e-06,-2.1476e-06,-2.2776e-06,-6.8127e-06,-2.2438e-05,-4.3421e-06,-7.5581e-07,-1.2636e-06,-5.8761e-06,-1.2993e-05,-1.6054e-05,-2.4103e-06,1.9889e-07,-7.5581e-07,1.2988e-07,1.2924e-07,1.2988e-07,1.2442e-07,1.3010e-07,1.6060e-07,1.3010e-07,1.5556e-07,1.3013e-07,-2.1681e-05,1.3013e-07,-1.5820e-05,1.5531e-05,-1.5531e-05,-1.1440e-04,1.1440e-04,-1.0723e-04,1.0723e-04,-1.3775e-06,1.3775e-06,1.1135e-04,-1.1135e-04,-1.4012e-06,1.4012e-06}
>>>> Re-trying (2/3).
Starting Function Value: 3.6508776531713405
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.650877635015299    0.000430969606496    5.229130125304360    0.000090105236445
         2            4    3.650877186624770    0.000335944994693    1.000000000000000    0.000077136351631
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.9747e-01,-9.8243e-01,-6.2556e-01,-3.9693e-02,-7.0467e-01,-9.0687e-01,3.0174e-01,-7.8504e-01,-3.9768e-01,-6.3776e-01,-1.6333e+00,-7.0467e-01,-1.5506e-01,-8.2974e-02,-3.4377e+00,2.5500e+00,-1.1422e+00,-1.6333e+00,-5.8052e-01,2.1602e-02,-3.2241e+00,2.4681e+00,-1.4441e+00,-1.1422e+00,-2.6639e-02,-1.2079e+00,1.4341e-01,4.6454e-04,-1.3665e+00,-1.4441e+00,-6.6702e-01,8.9549e-01,-1.1068e+00,-8.6126e-01,-7.9521e-01,-1.3665e+00,6.4223e-01,-1.1424e+00,-9.3157e-01,-6.5553e-01,-1.0188e+00,-7.9521e-01,-7.2452e-01,-5.7876e-01,-9.9600e-01,8.0084e-02,-6.6325e-01,-1.0188e+00,-7.2712e-01,-5.1009e-01,-8.8594e-01,-9.6208e-01,-1.5278e-01,-6.6325e-01,-5.8962e-02,-1.1531e+00,-7.7455e-01,-7.2966e-01,-1.0322e+00,-1.5278e-01,-5.8418e-01,-7.0907e-01,-2.0133e-01,-3.5496e-01,-9.7495e-01,-1.0322e+00,-8.7043e-01,-1.6831e-01,-6.3525e-01,-6.1290e-01,-5.9486e-01,-9.7495e-01,6.4947e-02,6.4630e-02,6.4947e-02,6.2217e-02,6.5060e-02,8.0309e-02,6.5060e-02,7.7788e-02,6.5074e-02,-2.1745e+00,6.5074e-02,-1.4875e+00,9.6677e-02,-9.6677e-02,-1.1131e-02,1.1131e-02,6.2133e-01,-6.2133e-01,6.3351e-01,-6.3351e-01,9.0460e-01,-9.0460e-01,1.0964e+00,-1.0964e+00}
> Gradient:  {-6.1964e-07,-2.6940e-06,-2.9264e-06,-5.9907e-06,-2.6255e-06,-4.0638e-06,-2.8994e-06,-5.4519e-06,-4.9894e-06,-2.3300e-06,-6.2386e-07,-2.6255e-06,8.4429e-08,-1.2883e-06,-2.0571e-06,-1.4773e-05,-3.5156e-07,-6.2386e-07,5.3269e-06,-1.3708e-05,1.6166e-06,-1.1624e-05,-2.6951e-07,-3.5156e-07,-2.7350e-06,-6.0584e-06,-7.0890e-06,-2.3926e-06,-4.6474e-07,-2.6951e-07,-5.8899e-06,-1.0904e-05,3.6751e-06,-1.2683e-06,-4.1573e-06,-4.6474e-07,-9.9619e-06,-9.8365e-07,2.4233e-07,-3.5082e-06,-6.4063e-07,-4.1573e-06,-8.9683e-07,-8.5981e-06,-8.2324e-06,-1.2699e-06,6.2852e-07,-6.4063e-07,-1.0753e-06,-1.0106e-05,-5.4671e-06,-8.9368e-08,-2.8997e-06,6.2852e-07,-1.5192e-05,-5.3159e-07,-2.0490e-06,2.9561e-06,-1.2935e-06,-2.8997e-06,1.5357e-06,-4.6526e-06,-1.1318e-05,-2.4193e-06,-7.7214e-07,-1.2935e-06,-4.4563e-06,-9.3118e-06,-3.8331e-06,-7.0251e-07,1.5571e-07,-7.7214e-07,1.2989e-07,1.2926e-07,1.2989e-07,1.2443e-07,1.3012e-07,1.6062e-07,1.3012e-07,1.5558e-07,1.3015e-07,-4.7092e-06,1.3015e-07,-1.3822e-05,5.5821e-06,-5.5821e-06,-2.5911e-05,2.5911e-05,-3.2092e-05,3.2092e-05,-7.3450e-08,7.3450e-08,-1.2587e-05,1.2587e-05,1.8172e-07,-1.8172e-07}
>>>> Re-trying (3/3).
After: gradient norm = 7.72389958245117E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0111,0.0111}

Count Table 2:
---------------
h:                 {0.6213,-0.6213}

Count Table 3:
---------------
h:                 {0.6335,-0.6335}

Count Table 4:
---------------
h:                 {0.9046,-0.9046}

Count Table 5:
---------------
h:                 {1.0964,-1.0964}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {-0.5975,-0.9824,-0.6256,-0.0397,-0.7047,-0.9069,0.3017,-0.7850,-0.3977,-0.6378,-1.6333,-0.7047,-0.1551,-0.0830,-3.4377,2.5500,-1.1422,-1.6333,-0.5805,0.0216,-3.2241,2.4681,-1.4441,-1.1422,-0.0266,-1.2079,0.1434,0.0005,-1.3665,-1.4441,-0.6670,0.8955,-1.1068,-0.8613,-0.7952,-1.3665,0.6422,-1.1424,-0.9316,-0.6555,-1.0188,-0.7952,-0.7245,-0.5788,-0.9960,0.0801,-0.6632,-1.0188,-0.7271,-0.5101,-0.8859,-0.9621,-0.1528,-0.6632,-0.0590,-1.1531,-0.7745,-0.7297,-1.0322,-0.1528,-0.5842,-0.7091,-0.2013,-0.3550,-0.9749,-1.0322,-0.8704,-0.1683,-0.6352,-0.6129,-0.5949,-0.9749}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0649,0.0646}
Activity(exp=1):   {0.0649,0.0622}
Activity(exp=2):   {0.0651,0.0803}
Activity(exp=3):   {0.0651,0.0778}
Activity(exp=4):   {0.0651,-2.1745}
Activity(exp=5):   {0.0651,-1.4875}

  The Likelihood DID improve.
Suggested variations:
key=12;10;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component3-2-variation7).
>>  Starting new optimization: component3-2-variation7. (2021-05-21 20:05:53.286).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[84,85]},{"h":[86,87]},{"h":[88,89]},{"h":[90,91]},{"h":[92,93]},{"h":[94,95]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71],"activity":[[72,73],[74,75],[76,77],[78,79],[80,81],[82,83]]}]}

Value and gradient before optimization:
=======================================
value         = 3.6508652303388702
gradient      = {0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0001,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0001,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0003,0.0003,-0.0004,0.0004}
gradient norm = 7.566674864909979E-4
Starting Function Value: 3.6508652303388702
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            4    3.650865130699362    0.000205859473516    0.272060683445653    0.000671026187331
         2            5    3.650864554481839    0.001685881089334    1.000000000000000    0.000117681725853
         3            6    3.650864521529198    0.000309976958292    1.000000000000000    0.000114653457431
         4            7    3.650864296820854    0.003803769034993    1.000000000000000    0.000084302426734
         5            9    3.650864274504667    0.000891244881839    0.411504304123673    0.000131470528827
         6           10    3.650864235340606    0.000950927852866    1.000000000000000    0.000111427270424
         7           11    3.650864060090755    0.005476692638537    1.000000000000000    0.000178181807412
         8           12    3.650863836954621    0.008604730539334    1.000000000000000    0.000280236976867
         9           13    3.650863562735293    0.016257459973351    1.000000000000000    0.000348051167260
        10           14    3.650863428010585    0.013086722042613    1.000000000000000    0.000295084526510
        11           15    3.650863310101447    0.004283089298610    1.000000000000000    0.000094034947975
        12           16    3.650863285825653    0.000990663605754    1.000000000000000    0.000058317698454
        13           17    3.650863267772548    0.000497363008503    1.000000000000000    0.000080923606325
        14           18    3.650863208629130    0.002341181107446    1.000000000000000    0.000158128641464
        15           19    3.650863099390272    0.005378813352414    1.000000000000000    0.000235235305319
        16           20    3.650862935008397    0.010313800586841    1.000000000000000    0.000265456515598
        17           22    3.650862859876431    0.005706435019795    0.285194192691972    0.000249979303360
        18           23    3.650862785828628    0.005368165171698    1.000000000000000    0.000118454184580
        19           24    3.650862762030422    0.001664722147382    1.000000000000000    0.000046996672142
        20           25    3.650862741160976    0.000405649851293    1.000000000000000    0.000063821408513
        21           26    3.650862711559147    0.001097725370392    1.000000000000000    0.000113979572327
        22           27    3.650862644281804    0.003205358575058    1.000000000000000    0.000188619412172
        23           28    3.650862504266006    0.008651339401823    1.000000000000000    0.000269183900659
        24           29    3.650862382584194    0.017651476624621    1.000000000000000    0.000398154862099
        25           30    3.650862197252853    0.010431539003831    1.000000000000000    0.000213501200640
        26           31    3.650862120505497    0.003648555552382    1.000000000000000    0.000088450528138
        27           34    3.650862106894990    0.000048421113318    0.018905610245958    0.000086929083619
        28           35    3.650862104459558    0.003218434875344    1.000000000000000    0.000048198904039
        29           36    3.650862086371659    0.000749805630938    1.000000000000000    0.000058978969710
        30           39    3.650862029936304    0.004991168723640    0.660000000000000    0.000120989927953
        31           40    3.650861892877445    0.013825358223154    1.000000000000000    0.000237848236894
        32           41    3.650861728255932    0.016633281514262    1.000000000000000    0.000285116359623
        33           42    3.650861500577029    0.022055861801570    1.000000000000000    0.000217066487610
        34           43    3.650861392933922    0.009939773672635    1.000000000000000    0.000081788823268
        35           44    3.650861355779872    0.002794066421839    1.000000000000000    0.000055786276162
        36           45    3.650861343439263    0.002184527103945    1.000000000000000    0.000080729728294
        37           46    3.650861325902409    0.002127906282439    1.000000000000000    0.000104667779254
        38           47    3.650861260144579    0.004515696722058    1.000000000000000    0.000149375076827
        39           48    3.650861103368737    0.008979206787243    1.000000000000000    0.000156393758614
        40           50    3.650860844326060    0.007381384755912    0.244656094346421    0.000192444598064
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.8682e-01,-9.7424e-01,-6.2608e-01,-4.3894e-02,-6.9690e-01,-8.8935e-01,2.9410e-01,-7.5881e-01,-3.9778e-01,-6.2900e-01,-1.6289e+00,-6.9690e-01,-1.6774e-01,-1.2874e-02,-3.4234e+00,2.5115e+00,-1.1398e+00,-1.6289e+00,-6.1896e-01,1.0977e-01,-3.2365e+00,2.4664e+00,-1.4421e+00,-1.1398e+00,-2.8873e-02,-1.1620e+00,1.3552e-01,-3.5006e-04,-1.3634e+00,-1.4421e+00,-6.5097e-01,8.9243e-01,-1.1275e+00,-8.5051e-01,-7.6120e-01,-1.3634e+00,6.2813e-01,-1.1144e+00,-9.2600e-01,-6.7408e-01,-1.0137e+00,-7.6120e-01,-7.1993e-01,-5.7566e-01,-9.8892e-01,9.6527e-02,-6.5954e-01,-1.0137e+00,-7.2756e-01,-4.9216e-01,-8.7461e-01,-9.6185e-01,-1.4544e-01,-6.5954e-01,-4.8361e-02,-1.1441e+00,-7.6170e-01,-7.3789e-01,-1.0237e+00,-1.4544e-01,-5.7781e-01,-7.0667e-01,-1.8950e-01,-3.4764e-01,-9.7197e-01,-1.0237e+00,-8.5792e-01,-1.4980e-01,-6.4270e-01,-6.0007e-01,-5.9482e-01,-9.7197e-01,6.3969e-02,6.3656e-02,6.3969e-02,6.1279e-02,6.4080e-02,7.9099e-02,6.4080e-02,7.6616e-02,6.4094e-02,-2.1600e+00,6.4094e-02,-1.4655e+00,9.6667e-02,-9.6667e-02,-1.1115e-02,1.1115e-02,6.2130e-01,-6.2130e-01,6.3328e-01,-6.3328e-01,9.0803e-01,-9.0803e-01,1.1021e+00,-1.1021e+00}
> Gradient:  {3.4558e-06,2.5397e-06,6.6095e-06,8.4139e-06,1.0125e-06,9.4695e-07,1.1014e-05,1.8985e-06,5.6191e-06,3.9313e-06,-4.9735e-07,1.0125e-06,3.4184e-06,1.2112e-06,-1.5805e-06,2.0601e-05,-2.6249e-07,-4.9735e-07,4.5608e-06,-3.5783e-06,1.7535e-06,2.0678e-05,-2.6090e-07,-2.6249e-07,8.8830e-06,4.8269e-06,1.3172e-06,8.5225e-06,-3.9816e-07,-2.6090e-07,5.0387e-06,2.0417e-05,-5.0350e-07,1.7031e-06,-3.3668e-06,-3.9816e-07,1.4551e-05,9.2286e-06,2.7661e-06,-2.6943e-09,-2.8586e-07,-3.3668e-06,6.7246e-06,5.1583e-06,3.2129e-06,9.0137e-06,-9.3307e-07,-2.8586e-07,4.3458e-06,8.6729e-06,5.5952e-06,2.6162e-06,2.5937e-06,-9.3307e-07,8.9639e-06,1.9928e-06,8.9317e-06,1.0694e-06,-6.6084e-07,2.5937e-06,4.3487e-06,2.2715e-06,8.6422e-06,8.5019e-06,-1.2501e-07,-6.6084e-07,5.2610e-06,6.5737e-06,5.5492e-06,5.7925e-06,-7.2919e-08,-1.2501e-07,1.2794e-07,1.2731e-07,1.2794e-07,1.2256e-07,1.2816e-07,1.5820e-07,1.2816e-07,1.5323e-07,1.2819e-07,3.6905e-06,1.2819e-07,1.9671e-05,7.3560e-07,-7.3560e-07,-1.8350e-05,1.8350e-05,-4.5323e-05,4.5323e-05,-1.0150e-04,1.0150e-04,-3.9240e-05,3.9240e-05,-5.1126e-05,5.1126e-05}
>>>> Re-trying (1/3).
Starting Function Value: 3.650861708220826
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.650861080498250    0.000446975301032    2.323132432086159    0.000025740428692
         2            4    3.650861078999871    0.000061588104419    1.000000000000000    0.000024439393534
         3            5    3.650861061355624    0.001178905618943    1.000000000000000    0.000038319406211
Gradient   = {-2.1734e-06,-1.2258e-06,-1.3910e-06,-2.0268e-06,4.1144e-07,2.5759e-07,-1.1955e-06,-2.3867e-06,-1.8163e-06,-6.5158e-07,-5.0927e-07,4.1144e-07,1.9894e-06,-6.9172e-07,-1.6424e-06,-5.1120e-06,-2.6977e-07,-5.0927e-07,3.6326e-06,-5.1053e-06,1.6718e-06,-5.8894e-06,-2.7560e-07,-2.6977e-07,9.1427e-07,2.7002e-07,-7.2703e-06,5.8719e-07,-4.6127e-07,-2.7560e-07,1.8825e-06,-7.7701e-07,-2.4893e-06,-9.0733e-07,-3.4832e-06,-4.6127e-07,-4.6481e-06,4.7503e-06,1.6430e-06,-3.9983e-06,-4.9933e-07,-3.4832e-06,1.7017e-06,-5.1696e-06,-1.4449e-06,6.9972e-07,-1.5233e-06,-4.9933e-07,7.2629e-08,-2.5860e-06,-1.2960e-06,-1.1925e-06,2.8938e-07,-1.5233e-06,-2.6122e-06,-1.9678e-06,1.9162e-06,-2.9735e-06,-8.8783e-07,2.8938e-07,-1.4761e-06,-3.0572e-06,-3.6810e-06,3.2601e-06,-3.0594e-07,-8.8783e-07,1.8125e-06,-2.9237e-06,-6.0285e-06,1.8194e-06,-5.2165e-07,-3.0594e-07,1.2792e-07,1.2730e-07,1.2792e-07,1.2255e-07,1.2815e-07,1.5818e-07,1.2815e-07,1.5322e-07,1.2817e-07,-4.5270e-06,1.2817e-07,-1.2375e-06,6.9327e-08,-6.9327e-08,-2.5341e-06,2.5341e-06,-5.8798e-06,5.8798e-06,1.9154e-05,-1.9154e-05,-2.8252e-06,2.8252e-06,9.4707e-06,-9.4707e-06}
pCurr      = {2.7424e-05,1.7820e-05,-2.9247e-05,-5.8903e-05,-2.4703e-05,-1.9356e-05,-1.2571e-04,7.4919e-05,-4.4637e-06,-3.0188e-05,2.3180e-05,-2.4703e-05,-1.0223e-04,2.8088e-05,7.4714e-05,-1.1899e-04,1.2267e-05,2.3180e-05,-1.7199e-04,2.2921e-04,-7.6149e-05,-8.8873e-05,1.2570e-05,1.2267e-05,-1.5502e-04,-5.7861e-05,2.3865e-04,-1.4232e-04,2.1010e-05,1.2570e-05,-1.2391e-04,-2.5438e-04,1.0177e-04,1.2347e-05,1.6020e-04,2.1010e-05,-7.0248e-05,-2.5830e-04,-7.5589e-05,1.3957e-04,2.1400e-05,1.6020e-04,-1.4488e-04,1.0110e-04,1.6869e-05,-1.4110e-04,6.3647e-05,2.1400e-05,-5.6932e-05,-2.8172e-05,-1.6031e-05,9.0323e-07,-4.6385e-05,6.3647e-05,-3.8958e-05,4.5802e-05,-1.6430e-04,8.2730e-05,3.8146e-05,-4.6385e-05,-4.9371e-06,7.9088e-05,7.3982e-06,-2.1923e-04,1.2568e-05,3.8146e-05,-1.2273e-04,1.2645e-05,1.2827e-04,-1.3636e-04,1.8653e-05,1.2568e-05,-5.8230e-06,-5.7946e-06,-5.8230e-06,-5.5782e-06,-5.8332e-06,-7.2003e-06,-5.8332e-06,-6.9743e-06,-5.8344e-06,1.2637e-04,-5.8344e-06,-2.3080e-04,-4.5904e-07,4.5904e-07,4.1323e-07,-4.1323e-07,2.2788e-05,-2.2788e-05,-2.0439e-05,2.0439e-05,2.9392e-05,-2.9392e-05,-1.1318e-04,1.1318e-04}
grad*pCur  = -1.371009634435682E-8
parameters = {-5.8683e-01,-9.7424e-01,-6.2616e-01,-4.4051e-02,-6.9693e-01,-8.8938e-01,2.9385e-01,-7.5874e-01,-3.9783e-01,-6.2907e-01,-1.6289e+00,-6.9693e-01,-1.6787e-01,-1.2841e-02,-3.4233e+00,2.5111e+00,-1.1397e+00,-1.6289e+00,-6.1916e-01,1.1003e-01,-3.2366e+00,2.4661e+00,-1.4420e+00,-1.1397e+00,-2.9119e-02,-1.1621e+00,1.3574e-01,-5.8315e-04,-1.3634e+00,-1.4420e+00,-6.5114e-01,8.9196e-01,-1.1274e+00,-8.5051e-01,-7.6101e-01,-1.3634e+00,6.2788e-01,-1.1147e+00,-9.2609e-01,-6.7394e-01,-1.0136e+00,-7.6101e-01,-7.2014e-01,-5.7562e-01,-9.8893e-01,9.6300e-02,-6.5947e-01,-1.0136e+00,-7.2766e-01,-4.9228e-01,-8.7467e-01,-9.6188e-01,-1.4552e-01,-6.5947e-01,-4.8498e-02,-1.1440e+00,-7.6193e-01,-7.3783e-01,-1.0237e+00,-1.4552e-01,-5.7786e-01,-7.0661e-01,-1.8958e-01,-3.4794e-01,-9.7195e-01,-1.0237e+00,-8.5809e-01,-1.4986e-01,-6.4264e-01,-6.0026e-01,-5.9480e-01,-9.7195e-01,6.3962e-02,6.3649e-02,6.3962e-02,6.1273e-02,6.4073e-02,7.9090e-02,6.4073e-02,7.6608e-02,6.4087e-02,-2.1599e+00,6.4087e-02,-1.4660e+00,9.6665e-02,-9.6665e-02,-1.1081e-02,1.1081e-02,6.2138e-01,-6.2138e-01,6.3356e-01,-6.3356e-01,9.0803e-01,-9.0803e-01,1.1020e+00,-1.1020e+00}
|grad|/|x| = 3.9844473002814466E-6
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.8683e-01,-9.7424e-01,-6.2616e-01,-4.4051e-02,-6.9693e-01,-8.8938e-01,2.9385e-01,-7.5874e-01,-3.9783e-01,-6.2907e-01,-1.6289e+00,-6.9693e-01,-1.6787e-01,-1.2841e-02,-3.4233e+00,2.5111e+00,-1.1397e+00,-1.6289e+00,-6.1916e-01,1.1003e-01,-3.2366e+00,2.4661e+00,-1.4420e+00,-1.1397e+00,-2.9119e-02,-1.1621e+00,1.3574e-01,-5.8290e-04,-1.3634e+00,-1.4420e+00,-6.5114e-01,8.9197e-01,-1.1274e+00,-8.5051e-01,-7.6101e-01,-1.3634e+00,6.2788e-01,-1.1147e+00,-9.2609e-01,-6.7394e-01,-1.0136e+00,-7.6101e-01,-7.2014e-01,-5.7562e-01,-9.8893e-01,9.6300e-02,-6.5947e-01,-1.0136e+00,-7.2766e-01,-4.9228e-01,-8.7467e-01,-9.6188e-01,-1.4552e-01,-6.5947e-01,-4.8498e-02,-1.1440e+00,-7.6193e-01,-7.3783e-01,-1.0237e+00,-1.4552e-01,-5.7786e-01,-7.0661e-01,-1.8958e-01,-3.4794e-01,-9.7195e-01,-1.0237e+00,-8.5809e-01,-1.4986e-01,-6.4264e-01,-6.0026e-01,-5.9480e-01,-9.7195e-01,6.3962e-02,6.3649e-02,6.3962e-02,6.1273e-02,6.4073e-02,7.9090e-02,6.4073e-02,7.6608e-02,6.4087e-02,-2.1599e+00,6.4087e-02,-1.4660e+00,9.6665e-02,-9.6665e-02,-1.1081e-02,1.1081e-02,6.2138e-01,-6.2138e-01,6.3356e-01,-6.3356e-01,9.0803e-01,-9.0803e-01,1.1020e+00,-1.1020e+00}
> Gradient:  {-2.1734e-06,-1.2258e-06,-1.3910e-06,-2.0268e-06,4.1144e-07,2.5759e-07,-1.1955e-06,-2.3867e-06,-1.8163e-06,-6.5158e-07,-5.0927e-07,4.1144e-07,1.9894e-06,-6.9172e-07,-1.6424e-06,-5.1120e-06,-2.6977e-07,-5.0927e-07,3.6326e-06,-5.1053e-06,1.6718e-06,-5.8894e-06,-2.7560e-07,-2.6977e-07,9.1427e-07,2.7002e-07,-7.2703e-06,5.8719e-07,-4.6127e-07,-2.7560e-07,1.8825e-06,-7.7701e-07,-2.4893e-06,-9.0733e-07,-3.4832e-06,-4.6127e-07,-4.6481e-06,4.7503e-06,1.6430e-06,-3.9983e-06,-4.9933e-07,-3.4832e-06,1.7017e-06,-5.1696e-06,-1.4449e-06,6.9972e-07,-1.5233e-06,-4.9933e-07,7.2629e-08,-2.5860e-06,-1.2960e-06,-1.1925e-06,2.8938e-07,-1.5233e-06,-2.6122e-06,-1.9678e-06,1.9162e-06,-2.9735e-06,-8.8783e-07,2.8938e-07,-1.4761e-06,-3.0572e-06,-3.6810e-06,3.2601e-06,-3.0594e-07,-8.8783e-07,1.8125e-06,-2.9237e-06,-6.0285e-06,1.8194e-06,-5.2165e-07,-3.0594e-07,1.2792e-07,1.2730e-07,1.2792e-07,1.2255e-07,1.2815e-07,1.5818e-07,1.2815e-07,1.5322e-07,1.2817e-07,-4.5270e-06,1.2817e-07,-1.2375e-06,6.9327e-08,-6.9327e-08,-2.5341e-06,2.5341e-06,-5.8798e-06,5.8798e-06,1.9154e-05,-1.9154e-05,-2.8252e-06,2.8252e-06,9.4707e-06,-9.4707e-06}
>>>> Re-trying (2/3).
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.8683e-01,-9.7424e-01,-6.2616e-01,-4.4051e-02,-6.9693e-01,-8.8938e-01,2.9385e-01,-7.5874e-01,-3.9783e-01,-6.2907e-01,-1.6289e+00,-6.9693e-01,-1.6787e-01,-1.2841e-02,-3.4233e+00,2.5111e+00,-1.1397e+00,-1.6289e+00,-6.1916e-01,1.1003e-01,-3.2366e+00,2.4661e+00,-1.4420e+00,-1.1397e+00,-2.9119e-02,-1.1621e+00,1.3574e-01,-5.8290e-04,-1.3634e+00,-1.4420e+00,-6.5114e-01,8.9197e-01,-1.1274e+00,-8.5051e-01,-7.6101e-01,-1.3634e+00,6.2788e-01,-1.1147e+00,-9.2609e-01,-6.7394e-01,-1.0136e+00,-7.6101e-01,-7.2014e-01,-5.7562e-01,-9.8893e-01,9.6300e-02,-6.5947e-01,-1.0136e+00,-7.2766e-01,-4.9228e-01,-8.7467e-01,-9.6188e-01,-1.4552e-01,-6.5947e-01,-4.8498e-02,-1.1440e+00,-7.6193e-01,-7.3783e-01,-1.0237e+00,-1.4552e-01,-5.7786e-01,-7.0661e-01,-1.8958e-01,-3.4794e-01,-9.7195e-01,-1.0237e+00,-8.5809e-01,-1.4986e-01,-6.4264e-01,-6.0026e-01,-5.9480e-01,-9.7195e-01,6.3962e-02,6.3649e-02,6.3962e-02,6.1273e-02,6.4073e-02,7.9090e-02,6.4073e-02,7.6608e-02,6.4087e-02,-2.1599e+00,6.4087e-02,-1.4660e+00,9.6665e-02,-9.6665e-02,-1.1081e-02,1.1081e-02,6.2138e-01,-6.2138e-01,6.3356e-01,-6.3356e-01,9.0803e-01,-9.0803e-01,1.1020e+00,-1.1020e+00}
> Gradient:  {-2.1720e-06,-1.2249e-06,-1.3888e-06,-2.0235e-06,4.1137e-07,2.5753e-07,-1.1914e-06,-2.3863e-06,-1.8144e-06,-6.5036e-07,-5.0928e-07,4.1137e-07,1.9895e-06,-6.9179e-07,-1.6424e-06,-5.1044e-06,-2.6977e-07,-5.0928e-07,3.6327e-06,-5.1052e-06,1.6718e-06,-5.8819e-06,-2.7561e-07,-2.6977e-07,9.1698e-07,2.7110e-07,-7.2690e-06,5.8983e-07,-4.6132e-07,-2.7561e-07,1.8832e-06,-7.7036e-07,-2.4892e-06,-9.0692e-07,-3.4834e-06,-4.6132e-07,-4.6422e-06,4.7513e-06,1.6433e-06,-3.9977e-06,-4.9939e-07,-3.4834e-06,1.7033e-06,-5.1671e-06,-1.4437e-06,7.0231e-07,-1.5234e-06,-4.9939e-07,7.3902e-08,-2.5831e-06,-1.2939e-06,-1.1912e-06,2.8970e-07,-1.5234e-06,-2.6092e-06,-1.9665e-06,1.9183e-06,-2.9725e-06,-8.8786e-07,2.8970e-07,-1.4745e-06,-3.0557e-06,-3.6780e-06,3.2617e-06,-3.0598e-07,-8.8786e-07,1.8134e-06,-2.9206e-06,-6.0260e-06,1.8206e-06,-5.2167e-07,-3.0598e-07,1.2792e-07,1.2730e-07,1.2792e-07,1.2255e-07,1.2815e-07,1.5818e-07,1.2815e-07,1.5322e-07,1.2817e-07,-4.5208e-06,1.2817e-07,-1.2360e-06,7.3530e-08,-7.3530e-08,-2.5432e-06,2.5432e-06,-5.8984e-06,5.8984e-06,1.8982e-05,-1.8982e-05,-2.8617e-06,2.8617e-06,9.4935e-06,-9.4935e-06}
>>>> Re-trying (3/3).
After: gradient norm = 3.8320571749960174E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0111,0.0111}

Count Table 2:
---------------
h:                 {0.6214,-0.6214}

Count Table 3:
---------------
h:                 {0.6336,-0.6336}

Count Table 4:
---------------
h:                 {0.9080,-0.9080}

Count Table 5:
---------------
h:                 {1.1020,-1.1020}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {-0.5868,-0.9742,-0.6262,-0.0441,-0.6969,-0.8894,0.2939,-0.7587,-0.3978,-0.6291,-1.6289,-0.6969,-0.1679,-0.0128,-3.4233,2.5111,-1.1397,-1.6289,-0.6192,0.1100,-3.2366,2.4661,-1.4420,-1.1397,-0.0291,-1.1621,0.1357,-0.0006,-1.3634,-1.4420,-0.6511,0.8920,-1.1274,-0.8505,-0.7610,-1.3634,0.6279,-1.1147,-0.9261,-0.6739,-1.0136,-0.7610,-0.7201,-0.5756,-0.9889,0.0963,-0.6595,-1.0136,-0.7277,-0.4923,-0.8747,-0.9619,-0.1455,-0.6595,-0.0485,-1.1440,-0.7619,-0.7378,-1.0237,-0.1455,-0.5779,-0.7066,-0.1896,-0.3479,-0.9720,-1.0237,-0.8581,-0.1499,-0.6426,-0.6003,-0.5948,-0.9720}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0640,0.0636}
Activity(exp=1):   {0.0640,0.0613}
Activity(exp=2):   {0.0641,0.0791}
Activity(exp=3):   {0.0641,0.0766}
Activity(exp=4):   {0.0641,-2.1599}
Activity(exp=5):   {0.0641,-1.4660}

  The Likelihood DID improve.
Suggested variations:
key=12;11;0, description = Increases flank length.
> Optimizing variation "Increases flank length." (component3-2-variation8).
>>  Starting new optimization: component3-2-variation8. (2021-05-21 20:09:30.766).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{},{}],"countTable":[{"h":[84,85]},{"h":[86,87]},{"h":[88,89]},{"h":[90,91]},{"h":[92,93]},{"h":[94,95]}],"bindingModeInteractions":[],"bindingModes":[{},{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71],"activity":[[72,73],[74,75],[76,77],[78,79],[80,81],[82,83]]}]}

Value and gradient before optimization:
=======================================
value         = 3.6508589087637273
gradient      = {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0001,0.0001,-0.0002,0.0002}
gradient norm = 3.413682005785421E-4
Starting Function Value: 3.6508589087637273
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.650858771889364    0.000793622665889    2.324828922388398    0.000044708128435
         2            7    3.650858769306272    0.000059625536101    0.560755837094259    0.000043022137352
         3            8    3.650858751227013    0.002009003655420    1.000000000000000    0.000114589205243
         4            9    3.650858737514390    0.000488235225237    1.000000000000000    0.000070799632239
         5           10    3.650858730482380    0.000377356882705    1.000000000000000    0.000020908977643
         6           11    3.650858690435751    0.000084783492460    1.000000000000000    0.000018779490854
         7           13    3.650857951227020    0.000319383541209    0.166108323100042    0.000019566156906
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.8673e-01,-9.7401e-01,-6.2609e-01,-4.3894e-02,-6.9697e-01,-8.8940e-01,2.9411e-01,-7.5863e-01,-3.9770e-01,-6.2909e-01,-1.6288e+00,-6.9697e-01,-1.6807e-01,-1.2701e-02,-3.4232e+00,2.5115e+00,-1.1397e+00,-1.6288e+00,-6.1946e-01,1.1054e-01,-3.2368e+00,2.4664e+00,-1.4420e+00,-1.1397e+00,-2.9216e-02,-1.1622e+00,1.3637e-01,-5.5173e-04,-1.3634e+00,-1.4420e+00,-6.5134e-01,8.9217e-01,-1.1272e+00,-8.5049e-01,-7.6072e-01,-1.3634e+00,6.2827e-01,-1.1150e+00,-9.2622e-01,-6.7369e-01,-1.0136e+00,-7.6072e-01,-7.2031e-01,-5.7517e-01,-9.8888e-01,9.6320e-02,-6.5934e-01,-1.0136e+00,-7.2772e-01,-4.9213e-01,-8.7464e-01,-9.6167e-01,-1.4549e-01,-6.5934e-01,-4.8293e-02,-1.1440e+00,-7.6204e-01,-7.3762e-01,-1.0236e+00,-1.4549e-01,-5.7777e-01,-7.0639e-01,-1.8925e-01,-3.4818e-01,-9.7193e-01,-1.0236e+00,-8.5813e-01,-1.4963e-01,-6.4199e-01,-6.0062e-01,-5.9481e-01,-9.7193e-01,6.3951e-02,6.3639e-02,6.3951e-02,6.1263e-02,6.4063e-02,7.9077e-02,6.4063e-02,7.6595e-02,6.4076e-02,-2.1595e+00,6.4076e-02,-1.4659e+00,9.6665e-02,-9.6665e-02,-1.1074e-02,1.1074e-02,6.2140e-01,-6.2140e-01,6.3352e-01,-6.3352e-01,9.0859e-01,-9.0859e-01,1.1027e+00,-1.1027e+00}
> Gradient:  {3.6388e-07,-2.0651e-06,6.6361e-07,1.3139e-06,4.6300e-07,4.4783e-07,5.9930e-07,-7.7696e-07,-1.8039e-09,1.4047e-06,-5.0115e-07,4.6300e-07,2.5459e-06,-1.9702e-06,-1.6191e-06,2.9113e-06,-2.6742e-07,-5.0115e-07,3.6423e-06,-6.3772e-06,1.6970e-06,2.6734e-06,-2.6880e-07,-2.6742e-07,2.7336e-06,1.6878e-06,-4.0994e-06,1.4687e-06,-4.2250e-07,-2.6880e-07,3.0917e-06,3.5278e-06,-1.8872e-06,4.0589e-07,-3.6163e-06,-4.2250e-07,1.8537e-06,3.8263e-06,1.4615e-06,-2.0049e-06,-4.2097e-07,-3.6163e-06,2.8030e-06,-8.6196e-07,-1.3995e-07,1.1898e-06,-1.4706e-06,-4.2097e-07,1.2945e-06,2.9779e-06,-1.3533e-07,-1.6611e-06,9.3957e-08,-1.4706e-06,2.2465e-06,-4.3309e-07,1.5389e-06,-1.5132e-06,-8.3375e-07,9.3957e-08,-9.7430e-09,-1.7824e-06,5.2901e-07,3.5781e-06,-2.9408e-07,-8.3375e-07,7.6319e-07,-6.5813e-07,-3.4949e-06,4.7432e-06,1.2782e-07,-2.9408e-07,1.2790e-07,1.2728e-07,1.2790e-07,1.2253e-07,1.2813e-07,1.5815e-07,1.2813e-07,1.5319e-07,1.2815e-07,-2.4258e-06,1.2815e-07,3.9963e-06,-1.3513e-08,1.3513e-08,8.2084e-07,-8.2084e-07,1.3221e-06,-1.3221e-06,9.3514e-07,-9.3514e-07,4.8055e-06,-4.8055e-06,-2.2413e-06,2.2413e-06}
>>>> Re-trying (1/3).
Starting Function Value: 3.650858723258416
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.650858720853137    0.000250523211335   12.876852965635424    0.000038580783765
         2            4    3.650858717148604    0.000217373529672    1.000000000000000    0.000036012023041
         3            5    3.650858716791960    0.005805363054952    1.000000000000000    0.000172528938436
         4            6    3.650858666350694    0.001004268367010    1.000000000000000    0.000059840494941
Gradient   = {-3.4986e-06,-2.8095e-06,-4.5710e-06,-7.9261e-06,1.7456e-07,9.0204e-08,-9.0384e-06,-1.5403e-06,-4.8716e-06,-2.7769e-06,-4.8777e-07,1.7456e-07,2.2565e-06,-9.8688e-07,-1.5797e-06,-1.7568e-05,-2.6194e-07,-4.8777e-07,3.3736e-06,-5.5364e-06,1.7304e-06,-1.7680e-05,-2.5350e-07,-2.6194e-07,-5.8625e-06,-1.0850e-06,-4.8859e-06,-6.1660e-06,-3.7519e-07,-2.5350e-07,3.3144e-07,-1.2361e-05,-1.7895e-06,-1.0686e-06,-3.3649e-06,-3.7519e-07,-1.4293e-05,1.2376e-06,1.6420e-06,-3.3957e-06,-4.5400e-07,-3.3649e-06,-2.2481e-06,-7.2405e-06,-2.6054e-06,-4.4397e-06,-1.6404e-06,-4.5400e-07,-2.2808e-06,-5.0270e-06,-4.2827e-06,-3.8717e-06,-1.5255e-06,-1.6404e-06,-6.9912e-06,-2.4639e-06,-2.6815e-06,-4.0454e-06,-9.2051e-07,-1.5255e-06,-3.8884e-06,-4.0687e-06,-7.8898e-06,-1.4625e-06,-3.1054e-07,-9.2051e-07,-1.5520e-06,-6.3816e-06,-1.0003e-05,-1.6127e-07,-1.3152e-07,-3.1054e-07,1.2779e-07,1.2717e-07,1.2779e-07,1.2242e-07,1.2802e-07,1.5802e-07,1.2802e-07,1.5306e-07,1.2804e-07,-6.3968e-06,1.2804e-07,-1.1761e-05,-1.4446e-07,1.4446e-07,1.6903e-05,-1.6903e-05,1.8847e-05,-1.8847e-05,3.3048e-06,-3.3048e-06,-1.5966e-06,1.5966e-06,-1.0729e-05,1.0729e-05}
pCurr      = {1.6749e-05,-5.5840e-05,2.8495e-05,5.3527e-05,1.2583e-05,1.2258e-05,3.4284e-05,-2.1008e-05,9.2976e-06,4.6531e-05,-1.3916e-05,1.2583e-05,7.0495e-05,-5.7231e-05,-4.4874e-05,1.1829e-04,-7.4233e-06,-1.3916e-05,1.0089e-04,-1.7820e-04,4.6842e-05,1.1074e-04,-7.5027e-06,-7.4233e-06,9.1842e-05,5.1465e-05,-1.1307e-04,5.4544e-05,-1.1932e-05,-7.5027e-06,9.0222e-05,1.2766e-04,-5.2990e-05,1.3351e-05,-1.0097e-04,-1.1932e-05,8.1073e-05,1.1008e-04,4.0890e-05,-5.3790e-05,-1.1942e-05,-1.0097e-04,8.6586e-05,-1.1054e-05,2.8850e-07,4.2617e-05,-4.1151e-05,-1.1942e-05,4.2298e-05,9.8923e-05,3.7458e-06,-4.2207e-05,3.7367e-06,-4.1151e-05,8.0014e-05,-7.5539e-06,4.9887e-05,-3.7548e-05,-2.3191e-05,3.7367e-06,6.3732e-06,-4.5054e-05,3.0422e-05,1.0761e-04,-8.3910e-06,-2.3191e-05,2.4619e-05,-6.7189e-06,-8.5239e-05,1.3999e-04,3.5132e-06,-8.3910e-06,3.5376e-06,3.5203e-06,3.5376e-06,3.3888e-06,3.5437e-06,4.3743e-06,3.5437e-06,4.2370e-06,3.5445e-06,-4.3670e-05,3.5445e-06,1.2205e-04,1.6056e-07,-1.6056e-07,-2.1211e-05,2.1211e-05,-2.1803e-05,2.1803e-05,-1.1497e-06,1.1497e-06,2.3193e-05,-2.3193e-05,6.6432e-05,-6.6432e-05}
grad*pCur  = -9.846176529746443E-9
parameters = {-5.8680e-01,-9.7311e-01,-6.2628e-01,-4.4264e-02,-6.9715e-01,-8.8958e-01,2.9405e-01,-7.5827e-01,-3.9760e-01,-6.2961e-01,-1.6286e+00,-6.9715e-01,-1.6914e-01,-1.1869e-02,-3.4225e+00,2.5107e+00,-1.1396e+00,-1.6286e+00,-6.2100e-01,1.1324e-01,-3.2375e+00,2.4657e+00,-1.4419e+00,-1.1396e+00,-3.0218e-02,-1.1629e+00,1.3817e-01,-1.0223e-03,-1.3632e+00,-1.4419e+00,-6.5260e-01,8.9099e-01,-1.1264e+00,-8.5063e-01,-7.5918e-01,-1.3632e+00,6.2782e-01,-1.1166e+00,-9.2686e-01,-6.7279e-01,-1.0134e+00,-7.5918e-01,-7.2141e-01,-5.7467e-01,-9.8877e-01,9.5937e-02,-6.5870e-01,-1.0134e+00,-7.2820e-01,-4.9325e-01,-8.7450e-01,-9.6091e-01,-1.4547e-01,-6.5870e-01,-4.9063e-02,-1.1437e+00,-7.6261e-01,-7.3692e-01,-1.0232e+00,-1.4547e-01,-5.7768e-01,-7.0558e-01,-1.8930e-01,-3.4960e-01,-9.7180e-01,-1.0232e+00,-8.5840e-01,-1.4924e-01,-6.4034e-01,-6.0254e-01,-5.9485e-01,-9.7180e-01,6.3897e-02,6.3585e-02,6.3897e-02,6.1211e-02,6.4008e-02,7.9010e-02,6.4008e-02,7.6530e-02,6.4022e-02,-2.1586e+00,6.4022e-02,-1.4671e+00,9.6665e-02,-9.6665e-02,-1.1040e-02,1.1040e-02,6.2144e-01,-6.2144e-01,6.3352e-01,-6.3352e-01,9.0849e-01,-9.0849e-01,1.1023e+00,-1.1023e+00}
|grad|/|x| = 6.204759015027985E-6
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.8680e-01,-9.7311e-01,-6.2628e-01,-4.4264e-02,-6.9715e-01,-8.8958e-01,2.9405e-01,-7.5827e-01,-3.9760e-01,-6.2961e-01,-1.6286e+00,-6.9715e-01,-1.6914e-01,-1.1869e-02,-3.4225e+00,2.5107e+00,-1.1396e+00,-1.6286e+00,-6.2100e-01,1.1324e-01,-3.2375e+00,2.4657e+00,-1.4419e+00,-1.1396e+00,-3.0218e-02,-1.1629e+00,1.3817e-01,-1.0223e-03,-1.3632e+00,-1.4419e+00,-6.5260e-01,8.9099e-01,-1.1264e+00,-8.5063e-01,-7.5918e-01,-1.3632e+00,6.2782e-01,-1.1166e+00,-9.2686e-01,-6.7279e-01,-1.0134e+00,-7.5918e-01,-7.2141e-01,-5.7467e-01,-9.8877e-01,9.5937e-02,-6.5870e-01,-1.0134e+00,-7.2820e-01,-4.9325e-01,-8.7450e-01,-9.6091e-01,-1.4547e-01,-6.5870e-01,-4.9063e-02,-1.1437e+00,-7.6261e-01,-7.3692e-01,-1.0232e+00,-1.4547e-01,-5.7768e-01,-7.0558e-01,-1.8930e-01,-3.4960e-01,-9.7180e-01,-1.0232e+00,-8.5840e-01,-1.4924e-01,-6.4034e-01,-6.0254e-01,-5.9485e-01,-9.7180e-01,6.3897e-02,6.3585e-02,6.3897e-02,6.1211e-02,6.4008e-02,7.9010e-02,6.4008e-02,7.6530e-02,6.4022e-02,-2.1586e+00,6.4022e-02,-1.4671e+00,9.6665e-02,-9.6665e-02,-1.1040e-02,1.1040e-02,6.2144e-01,-6.2144e-01,6.3352e-01,-6.3352e-01,9.0849e-01,-9.0849e-01,1.1023e+00,-1.1023e+00}
> Gradient:  {-3.4986e-06,-2.8095e-06,-4.5710e-06,-7.9261e-06,1.7456e-07,9.0204e-08,-9.0384e-06,-1.5403e-06,-4.8716e-06,-2.7769e-06,-4.8777e-07,1.7456e-07,2.2565e-06,-9.8688e-07,-1.5797e-06,-1.7568e-05,-2.6194e-07,-4.8777e-07,3.3736e-06,-5.5364e-06,1.7304e-06,-1.7680e-05,-2.5350e-07,-2.6194e-07,-5.8625e-06,-1.0850e-06,-4.8859e-06,-6.1660e-06,-3.7519e-07,-2.5350e-07,3.3144e-07,-1.2361e-05,-1.7895e-06,-1.0686e-06,-3.3649e-06,-3.7519e-07,-1.4293e-05,1.2376e-06,1.6420e-06,-3.3957e-06,-4.5400e-07,-3.3649e-06,-2.2481e-06,-7.2405e-06,-2.6054e-06,-4.4397e-06,-1.6404e-06,-4.5400e-07,-2.2808e-06,-5.0270e-06,-4.2827e-06,-3.8717e-06,-1.5255e-06,-1.6404e-06,-6.9912e-06,-2.4639e-06,-2.6815e-06,-4.0454e-06,-9.2051e-07,-1.5255e-06,-3.8884e-06,-4.0687e-06,-7.8898e-06,-1.4625e-06,-3.1054e-07,-9.2051e-07,-1.5520e-06,-6.3816e-06,-1.0003e-05,-1.6127e-07,-1.3152e-07,-3.1054e-07,1.2779e-07,1.2717e-07,1.2779e-07,1.2242e-07,1.2802e-07,1.5802e-07,1.2802e-07,1.5306e-07,1.2804e-07,-6.3968e-06,1.2804e-07,-1.1761e-05,-1.4446e-07,1.4446e-07,1.6903e-05,-1.6903e-05,1.8847e-05,-1.8847e-05,3.3048e-06,-3.3048e-06,-1.5966e-06,1.5966e-06,-1.0729e-05,1.0729e-05}
>>>> Re-trying (2/3).
Starting Function Value: 3.650858666350694
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    3.650858655861283    0.000295611364225    4.939988623377404    0.000062182763247
stepAlphaMin = 1.0E-20
>>>> Exception caugth. Parameters reverted.
> Parameter: {-5.8679e-01,-9.7310e-01,-6.2626e-01,-4.4225e-02,-6.9715e-01,-8.8958e-01,2.9410e-01,-7.5826e-01,-3.9758e-01,-6.2960e-01,-1.6286e+00,-6.9715e-01,-1.6915e-01,-1.1864e-02,-3.4225e+00,2.5108e+00,-1.1396e+00,-1.6286e+00,-6.2102e-01,1.1327e-01,-3.2375e+00,2.4658e+00,-1.4419e+00,-1.1396e+00,-3.0189e-02,-1.1629e+00,1.3819e-01,-9.9179e-04,-1.3632e+00,-1.4419e+00,-6.5260e-01,8.9105e-01,-1.1264e+00,-8.5062e-01,-7.5916e-01,-1.3632e+00,6.2789e-01,-1.1166e+00,-9.2687e-01,-6.7278e-01,-1.0134e+00,-7.5916e-01,-7.2140e-01,-5.7463e-01,-9.8876e-01,9.5959e-02,-6.5869e-01,-1.0134e+00,-7.2819e-01,-4.9322e-01,-8.7448e-01,-9.6089e-01,-1.4547e-01,-6.5869e-01,-4.9028e-02,-1.1437e+00,-7.6259e-01,-7.3690e-01,-1.0232e+00,-1.4547e-01,-5.7766e-01,-7.0556e-01,-1.8926e-01,-3.4960e-01,-9.7180e-01,-1.0232e+00,-8.5839e-01,-1.4921e-01,-6.4029e-01,-6.0254e-01,-5.9485e-01,-9.7180e-01,6.3896e-02,6.3584e-02,6.3896e-02,6.1210e-02,6.4008e-02,7.9009e-02,6.4008e-02,7.6529e-02,6.4021e-02,-2.1586e+00,6.4021e-02,-1.4670e+00,9.6666e-02,-9.6666e-02,-1.1124e-02,1.1124e-02,6.2134e-01,-6.2134e-01,6.3351e-01,-6.3351e-01,9.0850e-01,-9.0850e-01,1.1024e+00,-1.1024e+00}
> Gradient:  {-2.7633e-06,-2.3675e-06,-3.5815e-06,-6.4402e-06,1.8772e-07,1.2033e-07,-7.3378e-06,-1.1090e-06,-3.9028e-06,-2.1938e-06,-4.8873e-07,1.8772e-07,2.3677e-06,-9.1776e-07,-1.5763e-06,-1.4054e-05,-2.6263e-07,-4.8873e-07,3.4242e-06,-5.4413e-06,1.7315e-06,-1.4128e-05,-2.5547e-07,-2.6263e-07,-4.8846e-06,-6.7726e-07,-3.5719e-06,-5.1603e-06,-3.8249e-07,-2.5547e-07,6.8255e-07,-9.4279e-06,-1.6357e-06,-7.6939e-07,-3.3991e-06,-3.8249e-07,-1.1440e-05,1.5465e-06,1.7404e-06,-2.9165e-06,-4.6324e-07,-3.3991e-06,-1.7304e-06,-5.4770e-06,-2.1457e-06,-3.4903e-06,-1.6253e-06,-4.6324e-07,-1.8178e-06,-3.1245e-06,-3.6367e-06,-3.3719e-06,-1.3559e-06,-1.6253e-06,-5.1204e-06,-1.9504e-06,-2.0668e-06,-3.5215e-06,-9.1700e-07,-1.3559e-06,-3.2107e-06,-3.4211e-06,-6.0252e-06,-9.5758e-07,-3.1273e-07,-9.1700e-07,-1.2673e-06,-5.0953e-06,-8.2660e-06,2.1174e-07,-1.1485e-07,-3.1273e-07,1.2779e-07,1.2717e-07,1.2779e-07,1.2242e-07,1.2802e-07,1.5802e-07,1.2802e-07,1.5306e-07,1.2804e-07,-4.3030e-06,1.2804e-07,-1.0158e-05,1.9187e-07,-1.9187e-07,-2.2590e-05,2.2590e-05,-2.4165e-05,2.4165e-05,-2.8820e-06,2.8820e-06,-9.5809e-06,9.5809e-06,-8.2763e-06,8.2763e-06}
>>>> Re-trying (3/3).
After: gradient norm = 6.218233802008635E-5
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.0967,-0.0967}

Count Table 1:
---------------
h:                 {-0.0111,0.0111}

Count Table 2:
---------------
h:                 {0.6213,-0.6213}

Count Table 3:
---------------
h:                 {0.6335,-0.6335}

Count Table 4:
---------------
h:                 {0.9085,-0.9085}

Count Table 5:
---------------
h:                 {1.1024,-1.1024}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0213}
Activity(exp=1):   {-0.0000,-0.1842}
Activity(exp=2):   {-0.0000,1.0347}
Activity(exp=3):   {-0.0000,0.8647}
Activity(exp=4):   {-0.0000,1.1203}
Activity(exp=5):   {-0.0000,1.2392}

Binding mode 1:
---------------
Mononucleotide:    {-0.5550,-1.1432,-0.3520,-0.7824,-0.8408,-1.0820,-0.3379,-0.9462,-0.7358,-1.0091,-0.8856,-0.8408,-0.6018,-1.0047,-1.6042,-0.1211,-0.5380,-0.8856,-0.5484,-0.6866,-2.1088,-0.4999,-0.3736,-0.5380,0.2763,-1.5901,-1.1310,-0.6695,-1.2675,-0.3736,-0.2446,-0.4619,-1.5282,-0.6963,-0.5568,-1.2675,-0.6963,-1.5282,-0.4619,-0.2446,-1.2675,-0.5568,-0.6695,-1.1310,-1.5901,0.2763,-0.3736,-1.2675,-0.4999,-2.1088,-0.6866,-0.5484,-0.5380,-0.3736,-0.1211,-1.6042,-1.0047,-0.6018,-0.8856,-0.5380,-1.0091,-0.7358,-0.9462,-0.3379,-0.8408,-0.8856,-0.7824,-0.3520,-1.1432,-0.5550,-1.0820,-0.8408}
Dinucleotide(d=1): {-0.2691,-0.4414,0.0083,-0.5357,0.6828,0.0000,-0.0065,-0.6207,-0.1889,-0.0277,-0.2994,0.0000,0.1556,0.4969,-0.1001,-0.1425,-0.7618,0.0000,0.0167,0.0648,-0.4358,-0.2617,-0.1663,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.2346,-0.4457,-0.0192,-0.0415,-0.3410,0.0000,-0.2142,-0.3762,-1.1626,0.6660,0.7491,0.0000,-0.3285,-0.2563,-0.5722,0.7152,-0.5043,0.0000,-0.3024,-0.2619,-0.2408,0.0080,0.0612,0.0000,0.8011,0.3815,0.2612,-1.3362,-1.1166,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-0.5578,-0.4918,0.1102,-0.1741,0.2727,0.0000,0.0540,0.3612,-1.5595,-0.2546,0.7970,0.0000,0.0466,0.3059,-0.8104,-0.0548,-0.4921,0.0000,0.3128,-0.3675,-1.6489,0.2050,-0.1056,0.0000,-0.8487,-0.6514,2.7568,-0.2381,-1.1397,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-0.1132,-0.3349,-0.8469,-0.1574,0.5667,0.0000,-1.7122,0.8435,-0.2304,0.4697,0.0810,0.0000,-0.8517,-0.1959,0.4216,-0.1629,0.1022,0.0000,1.4044,-1.2829,-0.1450,-1.1201,-0.9652,0.0000,-0.4556,-0.2176,0.1009,0.3979,-0.3255,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,1.8914,-0.7372,-1.2781,-0.2541,-0.1600,0.0000,-2.4074,0.9497,-0.6445,0.9941,1.3844,0.0000,1.0259,-0.7580,-0.2168,-0.2905,-1.3506,0.0000,0.2774,-0.3075,-0.5910,-0.3275,-0.1825,0.0000,1.1630,-1.1210,0.1901,-0.4242,-0.4773,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.3036,0.7750,-0.2660,-0.6482,0.0692,0.0000,-0.8169,0.0900,-2.2963,1.4876,-0.0058,0.0000,0.3758,-0.8472,2.3317,-2.2963,-0.5160,0.0000,0.1713,-0.4736,-0.8472,0.0900,-0.0894,0.0000,0.0286,0.1713,0.3758,-0.8169,-0.6525,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3659,-0.6525,-0.0894,-0.5160,-0.0058,-0.0061,0.0000,-0.4242,-0.3275,-0.2905,0.9941,-0.6482,0.0000,0.1901,-0.5910,-0.2168,-0.6445,-0.2660,0.0000,-1.1210,-0.3075,-0.7580,0.9497,0.7750,0.0000,1.1630,0.2774,1.0259,-2.4074,-0.3036,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2676,-0.4773,-0.1825,-1.3506,1.3844,0.0692,0.0000,0.3979,-1.1201,-0.1629,0.4697,-0.2541,0.0000,0.1009,-0.1450,0.4216,-0.2304,-1.2781,0.0000,-0.2176,-1.2829,-0.1959,0.8435,-0.7372,0.0000,-0.4556,1.4044,-0.8517,-1.7122,1.8914,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.3736,-0.3255,-0.9652,0.1022,0.0810,-0.1600,0.0000,-0.2381,0.2050,-0.0548,-0.2546,-0.1574,0.0000,2.7568,-1.6489,-0.8104,-1.5595,-0.8469,0.0000,-0.6514,-0.3675,0.3059,0.3612,-0.3349,0.0000,-0.8487,0.3128,0.0466,0.0540,-0.1132,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.5380,-1.1397,-0.1056,-0.4921,0.7970,0.5667,0.0000,-1.3362,0.0080,0.7152,0.6660,-0.1741,0.0000,0.2612,-0.2408,-0.5722,-1.1626,0.1102,0.0000,0.3815,-0.2619,-0.2563,-0.3762,-0.4918,0.0000,0.8011,-0.3024,-0.3285,-0.2142,-0.5578,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8856,-1.1166,0.0612,-0.5043,0.7491,0.2727,0.0000,-0.2617,-0.1425,-0.0277,-0.5357,-0.0415,0.0000,-0.4358,-0.1001,-0.1889,0.0083,-0.0192,0.0000,0.0648,0.4969,-0.6207,-0.4414,-0.4457,0.0000,0.0167,0.1556,-0.0065,-0.2691,-0.2346,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8408,-0.1663,-0.7618,-0.2994,0.6828,-0.3410,0.0000}
Activity(exp=0):   {0.0000,-0.0828}
Activity(exp=1):   {0.0000,0.1863}
Activity(exp=2):   {0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,-2.2413}
Activity(exp=5):   {0.0000,-2.6625}

Binding mode 2:
---------------
Mononucleotide:    {-0.5984,-0.9551,-0.3981,-0.5071,-0.7090,-0.7009,-0.0624,-0.5831,-0.6349,-0.9498,-0.9294,-0.7090,-0.9170,-1.0238,-1.5682,0.5906,-0.0314,-0.9294,-0.9541,-0.7740,-1.0864,-0.6529,-0.3803,-0.0314,0.4438,-1.5284,-0.6401,-0.3747,-1.3993,-0.3803,-0.9842,0.0752,-1.1872,-0.7588,0.3753,-1.3993,-0.7588,-1.1872,0.0752,-0.9842,-1.3993,0.3753,-0.3747,-0.6401,-1.5284,0.4438,-0.3803,-1.3993,-0.6529,-1.0864,-0.7740,-0.9541,-0.0314,-0.3803,0.5906,-1.5682,-1.0238,-0.9170,-0.9294,-0.0314,-0.9498,-0.6349,-0.5831,-0.0624,-0.7090,-0.9294,-0.5071,-0.3981,-0.9551,-0.5984,-0.7009,-0.7090}
Dinucleotide(d=1): {-0.2852,-0.3383,-0.0383,0.0498,0.0811,0.0000,-0.3078,-0.3191,-0.1561,-0.1274,0.0661,0.0000,0.0152,-0.1218,-0.2809,0.0148,0.0335,0.0000,0.3188,0.3951,0.0916,-0.5135,-0.7601,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,0.1855,-0.1103,-0.2157,-0.2625,-0.2322,0.0000,-0.2209,-0.2777,-0.5658,0.6876,0.3033,0.0000,0.0680,-0.0832,0.0068,-0.2664,-0.2195,0.0000,-0.3138,-0.3114,-0.7560,0.4028,0.3790,0.0000,0.6446,0.0643,0.2799,-1.1290,-0.6986,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.9810,-0.3039,-0.3688,0.7699,0.2345,0.0000,0.1428,0.1217,-0.6904,-0.6643,0.2873,0.0000,-0.1265,0.2385,-0.1869,-0.5364,-0.3008,0.0000,0.0898,-0.0847,-1.0657,-0.8714,0.5281,0.0000,-0.4294,-1.2464,1.8672,2.4404,-2.1670,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-0.4838,0.3747,-0.9897,-1.0987,1.3858,0.0000,-0.6360,0.2941,-0.5768,-0.1106,0.2221,0.0000,-0.3309,0.4657,-0.6164,-0.2217,0.1071,0.0000,0.5207,-0.7074,-0.6066,0.2330,-0.5051,0.0000,0.2102,-1.7707,2.0090,0.1803,-1.3591,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,0.6555,0.3694,-0.8723,-0.4507,0.2967,0.0000,-0.3775,0.6762,-0.0434,0.2502,-0.0859,0.0000,-0.0010,-0.6903,0.1604,-0.1939,-0.6240,0.0000,-0.6939,0.8055,-0.2242,-0.8455,0.2949,0.0000,-0.1959,0.7481,-0.3599,-0.7802,0.2182,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.3776,-1.4645,-0.6259,0.8811,0.5652,0.0000,0.1383,0.4446,-0.3554,-0.6957,-0.2508,0.0000,1.3873,-0.7695,0.2601,-0.3554,-0.4439,0.0000,-1.1108,0.5989,-0.7695,0.4446,-0.3538,0.0000,-0.7480,-1.1108,1.3873,0.1383,-0.1841,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.3065,-0.1841,-0.3538,-0.4439,-0.2508,-0.0041,0.0000,-0.7802,-0.8455,-0.1939,0.2502,0.8811,0.0000,-0.3599,-0.2242,0.1604,-0.0434,-0.6259,0.0000,0.7481,0.8055,-0.6903,0.6762,-1.4645,0.0000,-0.1959,-0.6939,-0.0010,-0.3775,0.3776,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.2383,0.2182,0.2949,-0.6240,-0.0859,0.5652,0.0000,0.1803,0.2330,-0.2217,-0.1106,-0.4507,0.0000,2.0090,-0.6066,-0.6164,-0.5768,-0.8723,0.0000,-1.7707,-0.7074,0.4657,0.2941,0.3694,0.0000,0.2102,0.5207,-0.3309,-0.6360,0.6555,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.2665,-1.3591,-0.5051,0.1071,0.2221,0.2967,0.0000,2.4404,-0.8714,-0.5364,-0.6643,-1.0987,0.0000,1.8672,-1.0657,-0.1869,-0.6904,-0.9897,0.0000,-1.2464,-0.0847,0.2385,0.1217,0.3747,0.0000,-0.4294,0.0898,-0.1265,0.1428,-0.4838,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0014,-2.1670,0.5281,-0.3008,0.2873,1.3858,0.0000,-1.1290,0.4028,-0.2664,0.6876,0.7699,0.0000,0.2799,-0.7560,0.0068,-0.5658,-0.3688,0.0000,0.0643,-0.3114,-0.0832,-0.2777,-0.3039,0.0000,0.6446,-0.3138,0.0680,-0.2209,-0.9810,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.8117,-0.6986,0.3790,-0.2195,0.3033,0.2345,0.0000,-0.5135,0.0148,-0.1274,0.0498,-0.2625,0.0000,0.0916,-0.2809,-0.1561,-0.0383,-0.2157,0.0000,0.3951,-0.1218,-0.3191,-0.3383,-0.1103,0.0000,0.3188,0.0152,-0.3078,-0.2852,0.1855,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.6493,-0.7601,0.0335,0.0661,0.0811,-0.2322,0.0000}
Activity(exp=0):   {0.0199,0.0239}
Activity(exp=1):   {0.0199,0.0246}
Activity(exp=2):   {0.0199,-2.0682}
Activity(exp=3):   {0.0199,-1.7003}
Activity(exp=4):   {0.0199,-0.5432}
Activity(exp=5):   {0.0199,-0.2725}

Binding mode 3:
---------------
Mononucleotide:    {-0.5868,-0.9731,-0.6263,-0.0442,-0.6972,-0.8896,0.2941,-0.7583,-0.3976,-0.6296,-1.6286,-0.6972,-0.1692,-0.0119,-3.4225,2.5108,-1.1396,-1.6286,-0.6210,0.1133,-3.2375,2.4658,-1.4419,-1.1396,-0.0302,-1.1629,0.1382,-0.0010,-1.3632,-1.4419,-0.6526,0.8910,-1.1264,-0.8506,-0.7592,-1.3632,0.6279,-1.1166,-0.9269,-0.6728,-1.0134,-0.7592,-0.7214,-0.5746,-0.9888,0.0960,-0.6587,-1.0134,-0.7282,-0.4932,-0.8745,-0.9609,-0.1455,-0.6587,-0.0490,-1.1437,-0.7626,-0.7369,-1.0232,-0.1455,-0.5777,-0.7056,-0.1893,-0.3496,-0.9718,-1.0232,-0.8584,-0.1492,-0.6403,-0.6025,-0.5949,-0.9718}
Dinucleotide(d=1): {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.000