ProBound fit generated on May 22, 2021

Status

±

Terminal Output
Builder file created
Configuration file
ProBound run
Sequence logos
Terminal output
Pipeline Output:
> Converts the configuration file to work on run server, checks input
  OK
> Builds configuration file
  OK
> Runs ProBound
  OK
> Runs Model Viewer
  OK

Configuration Builder File

±

ProBound builder configuration file:
[{"function": "optimizerSetting", "nThreads": 20, "lambdaL2": 1e-06}, {"function": "addTable", "leftFlank": "GTTCAGAGTTCTACAGTCCGACGATC", "countTableFile": "/public_html/public/jobs/95360d4ae086/countTable.0.tsv.gz", "modeledColumns": [0, 1, 2, 3], "nColumns": 4, "rightFlank": "CCCGGGTCGTATGCCGTCTTCTGCTTG", "inputFileType": "tsv.gz", "variableRegionLength": 30}, {"function": "addTable", "leftFlank": "GTTCAGAGTTCTACAGTCCGACGATCTGG", "countTableFile": "/public_html/public/jobs/95360d4ae086/countTable.1.tsv.gz", "modeledColumns": [0, 1, 2, 3], "nColumns": 4, "rightFlank": "CCAGCTGTCGTATGCCGTCTTCTGCTTG", "inputFileType": "tsv.gz", "variableRegionLength": 16}, {"function": "addTable", "leftFlank": "GTTCAGAGTTCTACAGTCCGACGATCTGG", "countTableFile": "/public_html/public/jobs/95360d4ae086/countTable.2.tsv.gz", "modeledColumns": [0, 1, 2], "nColumns": 3, "rightFlank": "CCAGCTGTCGTATGCCGTCTTCTGCTTG", "inputFileType": "tsv.gz", "variableRegionLength": 16}, {"function": "addTable", "leftFlank": "TGGGCCTGG", "countTableFile": "/public_html/public/jobs/95360d4ae086/countTable.3.tsv.gz", "modeledColumns": [0, 1], "nColumns": 2, "rightFlank": "CCAGG", "inputFileType": "tsv.gz", "variableRegionLength": 16}, {"function": "addTable", "leftFlank": "GTTCAGAGTTCTACAGTCCGACGATCTGG", "countTableFile": "/public_html/public/jobs/95360d4ae086/countTable.4.tsv.gz", "modeledColumns": [0, 1], "nColumns": 2, "rightFlank": "CCACGTCTCGTATGCCGTCTTCTGCTTG", "inputFileType": "tsv.gz", "variableRegionLength": 16}, {"function": "addSELEX", "bindingModes": [0, 1, 2, 3, 4], "bindingModeInteractions": [-1]}, {"function": "addSELEX", "bindingModes": [0, 1, 2, 3], "bindingModeInteractions": []}, {"function": "addSELEX", "bindingModes": [0, 3], "bindingModeInteractions": []}, {"function": "addSELEX", "bindingModes": [0, 2], "bindingModeInteractions": []}, {"function": "addSELEX", "bindingModes": [0, 4], "bindingModeInteractions": []}, {"function": "addNS"}, {"function": "addBindingMode", "flankLength": 7, "size": 13}, {"function": "addBindingMode", "flankLength": 5, "size": 8}, {"function": "addBindingMode", "flankLength": 5, "size": 8}, {"function": "addBindingMode", "flankLength": 5, "size": 8}, {"function": "bindingModeSeed", "index": 1, "mononucleotideIUPAC": "NATGATTTATGAN"}, {"function": "bindingModeSeed", "index": 2, "mononucleotideIUPAC": "NTTGAYRN"}, {"function": "bindingModeSeed", "index": 3, "mononucleotideIUPAC": "NTTATGGN"}, {"function": "bindingModeSeed", "index": 4, "mononucleotideIUPAC": "NNTGAYRN"}, {"function": "addInteraction", "bindingModes": [1, 4], "positionBias": false, "maxOverlap": 7}, {"function": "interactionConstraints", "index": 0, "experimentSpecificInteraction": true}, {"function": "output", "outputPath": "/public_html/public/jobs/95360d4ae086", "baseName": "fit", "storeHessian": false, "printTrajectory": false}]

Configuration File

±

ProBound configuration file:
{
  "modelSeeding": {"bindingModes": [
    {"seedScale": 1},
    {
      "mononucleotideIUPAC": "NATGATTTATGAN",
      "seedScale": 1
    },
    {
      "mononucleotideIUPAC": "NTTGAYRN",
      "seedScale": 1
    },
    {
      "mononucleotideIUPAC": "NTTATGGN",
      "seedScale": 1
    },
    {
      "mononucleotideIUPAC": "NNTGAYRN",
      "seedScale": 1
    }
  ]},
  "optimizerSetting": {
    "nThreads": 20,
    "likelihoodThreshold": 0,
    "lambdaL2": 1.0E-6,
    "patternSearchSettings": {},
    "pseudocount": 0,
    "minimizerType": "lbfgs",
    "nRetries": 3,
    "hkSettings": {},
    "output": {
      "storeHessian": false,
      "outputPath": "/public_html/public/jobs/95360d4ae086",
      "printTrajectory": false,
      "baseName": "fit",
      "printPSAM": false,
      "verbose": true
    },
    "lbfgsSettings": {},
    "sgdSettings": {},
    "fixedLibrarySize": false,
    "expBound": 40,
    "slbfgs_plsSettings": {},
    "slbfgsSettings": {}
  },
  "modelSettings": {
    "enrichmentModel": [
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [-1],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          1,
          2,
          3,
          4
        ],
        "modifications": []
      },
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          1,
          2,
          3
        ],
        "modifications": []
      },
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          3
        ],
        "modifications": []
      },
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          2
        ],
        "modifications": []
      },
      {
        "r0KUsed": 1,
        "round": 1,
        "bindingSaturation": false,
        "concentration": 1,
        "modelType": "SELEX",
        "bindingModeInteractions": [],
        "r0KsTested": [1],
        "bindingModes": [
          0,
          4
        ],
        "modifications": []
      }
    ],
    "countTable": [
      {
        "leftFlank": "GTTCAGAGTTCTACAGTCCGACGATC",
        "transliterate": {
          "in": [],
          "out": []
        },
        "variableRegionLength": 30,
        "modeledColumns": [
          0,
          1,
          2,
          3
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 4,
        "rightFlank": "CCCGGGTCGTATGCCGTCTTCTGCTTG",
        "countTableFile": "/public_html/public/jobs/95360d4ae086/countTable.0.tsv.gz"
      },
      {
        "leftFlank": "GTTCAGAGTTCTACAGTCCGACGATCTGG",
        "transliterate": {
          "in": [],
          "out": []
        },
        "variableRegionLength": 16,
        "modeledColumns": [
          0,
          1,
          2,
          3
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 4,
        "rightFlank": "CCAGCTGTCGTATGCCGTCTTCTGCTTG",
        "countTableFile": "/public_html/public/jobs/95360d4ae086/countTable.1.tsv.gz"
      },
      {
        "leftFlank": "GTTCAGAGTTCTACAGTCCGACGATCTGG",
        "transliterate": {
          "in": [],
          "out": []
        },
        "variableRegionLength": 16,
        "modeledColumns": [
          0,
          1,
          2
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 3,
        "rightFlank": "CCAGCTGTCGTATGCCGTCTTCTGCTTG",
        "countTableFile": "/public_html/public/jobs/95360d4ae086/countTable.2.tsv.gz"
      },
      {
        "leftFlank": "TGGGCCTGG",
        "transliterate": {
          "in": [],
          "out": []
        },
        "variableRegionLength": 16,
        "modeledColumns": [
          0,
          1
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 2,
        "rightFlank": "CCAGG",
        "countTableFile": "/public_html/public/jobs/95360d4ae086/countTable.3.tsv.gz"
      },
      {
        "leftFlank": "GTTCAGAGTTCTACAGTCCGACGATCTGG",
        "transliterate": {
          "in": [],
          "out": []
        },
        "variableRegionLength": 16,
        "modeledColumns": [
          0,
          1
        ],
        "inputFileType": "tsv.gz",
        "nColumns": 2,
        "rightFlank": "CCACGTCTCGTATGCCGTCTTCTGCTTG",
        "countTableFile": "/public_html/public/jobs/95360d4ae086/countTable.4.tsv.gz"
      }
    ],
    "bindingModeInteractions": [{
      "fitLogActivity": true,
      "maxSpacing": -1,
      "positionBias": false,
      "bindingModes": [
        1,
        4
      ],
      "maxOverlap": 7
    }],
    "bindingModes": [
      {
        "size": 0,
        "fitLogActivity": true,
        "flankLength": 0,
        "dinucleotideDistance": 0,
        "positionBias": false,
        "singleStrand": false,
        "modifications": []
      },
      {
        "size": 13,
        "fitLogActivity": true,
        "flankLength": 7,
        "dinucleotideDistance": 0,
        "positionBias": false,
        "singleStrand": false,
        "modifications": []
      },
      {
        "size": 8,
        "fitLogActivity": true,
        "flankLength": 5,
        "dinucleotideDistance": 0,
        "positionBias": false,
        "singleStrand": false,
        "modifications": []
      },
      {
        "size": 8,
        "fitLogActivity": true,
        "flankLength": 5,
        "dinucleotideDistance": 0,
        "positionBias": false,
        "singleStrand": false,
        "modifications": []
      },
      {
        "size": 8,
        "fitLogActivity": true,
        "flankLength": 5,
        "dinucleotideDistance": 0,
        "positionBias": false,
        "singleStrand": false,
        "modifications": []
      }
    ],
    "letterComplement": "C-G,A-T"
  },
  "modelFittingConstraints": {
    "enrichmentModel": [
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      },
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      },
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      },
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      },
      {
        "fitDelta": [false],
        "roundSpecificGamma": true,
        "fitRho": false,
        "roundSpecificDelta": true,
        "fitGamma": false,
        "trySaturation": false,
        "roundSpecificRho": true
      }
    ],
    "nShifts": 0,
    "countTable": [
      {},
      {},
      {},
      {},
      {}
    ],
    "addBindingModesSequentially": true,
    "bindingModeInteractions": [{
      "experimentSpecificInteraction": true,
      "experimentSpecificActivity": true,
      "roundSpecificActivity": true
    }],
    "flankLengths": [0],
    "singleModeLengthSweep": false,
    "bindingModes": [
      {
        "maxFlankLength": -1,
        "positionBiasBinWidth": 1,
        "optimizeSizeHeuristic": false,
        "maxSize": -1,
        "optimizeFlankLength": false,
        "symmetryString": "null",
        "roundSpecificActivity": true,
        "informationThreshold": 0.1,
        "optimizeMotifShift": false,
        "fittingStages": [],
        "optimizeMotifShiftHeuristic": false,
        "experimentSpecificPositionBias": true,
        "minSize": -1,
        "experimentSpecificActivity": true,
        "optimizeSize": false
      },
      {
        "maxFlankLength": -1,
        "positionBiasBinWidth": 1,
        "optimizeSizeHeuristic": false,
        "maxSize": -1,
        "optimizeFlankLength": false,
        "symmetryString": "null",
        "roundSpecificActivity": true,
        "informationThreshold": 0.1,
        "optimizeMotifShift": false,
        "fittingStages": [],
        "optimizeMotifShiftHeuristic": false,
        "experimentSpecificPositionBias": true,
        "minSize": -1,
        "experimentSpecificActivity": true,
        "optimizeSize": false
      },
      {
        "maxFlankLength": -1,
        "positionBiasBinWidth": 1,
        "optimizeSizeHeuristic": false,
        "maxSize": -1,
        "optimizeFlankLength": false,
        "symmetryString": "null",
        "roundSpecificActivity": true,
        "informationThreshold": 0.1,
        "optimizeMotifShift": false,
        "fittingStages": [],
        "optimizeMotifShiftHeuristic": false,
        "experimentSpecificPositionBias": true,
        "minSize": -1,
        "experimentSpecificActivity": true,
        "optimizeSize": false
      },
      {
        "maxFlankLength": -1,
        "positionBiasBinWidth": 1,
        "optimizeSizeHeuristic": false,
        "maxSize": -1,
        "optimizeFlankLength": false,
        "symmetryString": "null",
        "roundSpecificActivity": true,
        "informationThreshold": 0.1,
        "optimizeMotifShift": false,
        "fittingStages": [],
        "optimizeMotifShiftHeuristic": false,
        "experimentSpecificPositionBias": true,
        "minSize": -1,
        "experimentSpecificActivity": true,
        "optimizeSize": false
      },
      {
        "maxFlankLength": -1,
        "positionBiasBinWidth": 1,
        "optimizeSizeHeuristic": false,
        "maxSize": -1,
        "optimizeFlankLength": false,
        "symmetryString": "null",
        "roundSpecificActivity": true,
        "informationThreshold": 0.1,
        "optimizeMotifShift": false,
        "fittingStages": [],
        "optimizeMotifShiftHeuristic": false,
        "experimentSpecificPositionBias": true,
        "minSize": -1,
        "experimentSpecificActivity": true,
        "optimizeSize": false
      }
    ]
  }
}

Probound Text Output

±

Output from ProBound:
> Reading configuration JSON object and validating general schema.
> Validating configuration schema.
{"enrichmentModel":[{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true}],"nShifts":0,"countTable":[{},{},{},{},{}],"addBindingModesSequentially":true,"bindingModeInteractions":[{"experimentSpecificInteraction":true,"experimentSpecificActivity":true,"roundSpecificActivity":true}],"flankLengths":[0],"singleModeLengthSweep":false,"bindingModes":[{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false}]}
Entry=bindingModes, aEntry=[{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false},{"maxFlankLength":-1,"positionBiasBinWidth":1,"optimizeSizeHeuristic":false,"maxSize":-1,"optimizeFlankLength":false,"symmetryString":"null","roundSpecificActivity":true,"informationThreshold":0.1,"optimizeMotifShift":false,"fittingStages":[],"optimizeMotifShiftHeuristic":false,"experimentSpecificPositionBias":true,"minSize":-1,"experimentSpecificActivity":true,"optimizeSize":false}]
Entry=bindingModeInteractions, aEntry=[{"experimentSpecificInteraction":true,"experimentSpecificActivity":true,"roundSpecificActivity":true}]
Entry=countTable, aEntry=[{},{},{},{},{}]
Entry=enrichmentModel, aEntry=[{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true},{"fitDelta":[false],"roundSpecificGamma":true,"fitRho":false,"roundSpecificDelta":true,"fitGamma":false,"trySaturation":false,"roundSpecificRho":true}]
> Builds likelihood object.
>> Creating CombinedLikelihood object.
Alphabet
========
Letter Complement: C-G,A-T
Letter Order:      ACGT

Optimizer settings:
===================
lambdaL2         = 1.0E-6
pseudocount      = 0.0
expBound         = 40.0
fixedLibrarySize = false

>> Determining fitting order.

 Summary of experiments 
 ====================== 
Experiment 0:
-------------
Count table:      Count table 0
Enrichment model: SELEX enrichment model 0
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 1
                  Binding mode 2
                  Binding mode 3
                  Binding mode 4
Binding mode interactions: 
                  Binding mode interaction 0

Experiment 1:
-------------
Count table:      Count table 1
Enrichment model: SELEX enrichment model 1
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 1
                  Binding mode 2
                  Binding mode 3
Binding mode interactions: 
                  NONE

Experiment 2:
-------------
Count table:      Count table 2
Enrichment model: SELEX enrichment model 2
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 3
Binding mode interactions: 
                  NONE

Experiment 3:
-------------
Count table:      Count table 3
Enrichment model: SELEX enrichment model 3
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 2
Binding mode interactions: 
                  NONE

Experiment 4:
-------------
Count table:      Count table 4
Enrichment model: SELEX enrichment model 4
   Concentration: 1.0
Binding modes: 
                  Binding mode 0
                  Binding mode 4
Binding mode interactions: 
                  NONE

> Builds optimizer.
> Using LBFGS.
> Starting optimization.

==================================
== Starts fiting Binding mode 0 ==
==================================
> Optimizing h (component0-0-h).
>>  Starting new optimization: component0-0-h. (2021-05-22 07:15:13.236).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[0,1,2,3]},{"h":[4,5,6,7]},{"h":[8,9,10]},{"h":[11,12]},{"h":[13,14]}],"bindingModeInteractions":[{}],"bindingModes":[{},{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 33.5190647680196
gradient      = {0.7492,-0.2492,-0.2500,-0.2500,0.7485,-0.2485,-0.2500,-0.2500,0.6652,-0.3319,-0.3333,0.4985,-0.4985,0.4985,-0.4985}
gradient norm = 1.7757579408116433
Starting Function Value: 33.5190647680196
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3   24.724530287194536    5.000000000000001    2.815699079861446    1.718899031429035
         2            6   14.808615706844755   17.238941763050715    0.086652558693423    1.608875483185539
         3            8   11.569907253965678    5.858776958438730    0.423019013542229    1.319534370451339
         4            9    9.053155589258200    6.659933348249434    1.000000000000000    1.084172901211286
         5           10    7.064829985765493    2.477301282771641    1.000000000000000    0.565383031184155
         6           11    5.988598467317167    4.427693084026856    1.000000000000000    0.652424464135747
         7           12    5.492497452852487    2.358917509063844    1.000000000000000    0.394934832287524
         8           14    5.289176612975783    1.074702105658214    0.477338581992685    0.133923695743116
         9           15    5.266101938202641    0.425465394854886    1.000000000000000    0.062111071450719
        10           16    5.260425501843010    0.297636696961352    1.000000000000000    0.031466296209898
        11           17    5.258905128206733    0.095130377458612    1.000000000000000    0.005932999402124
        12           18    5.258845270041054    0.017249945453733    1.000000000000000    0.001657693482835
        13           19    5.258840275185509    0.006309421892579    1.000000000000000    0.000218356936022
        14           20    5.258840203300408    0.000794523137402    1.000000000000000    0.000036099218216
        15           21    5.258840200904013    0.000128844948309    1.000000000000000    0.000003863165533
        16           22    5.258840200877246    0.000128844948309    1.000000000000000    0.000000377774682
Convergence criteria met.
After: gradient norm = 3.7777468203046986E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {-10.6842,-3.5614,3.5614,10.6842}

Count Table 1:
---------------
h:                 {-9.7831,-3.2610,3.2610,9.7831}

Count Table 2:
---------------
h:                 {-6.5221,0.0000,6.5221}

Count Table 3:
---------------
h:                 {-3.2610,3.2610}

Count Table 4:
---------------
h:                 {-3.2610,3.2610}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-7.1229,-7.1229,-7.1229,-7.1229}
Activity(exp=1):   {-6.5221,-6.5221,-6.5221,-6.5221}
Activity(exp=2):   {-6.5221,-6.5221,-6.5221}
Activity(exp=3):   {-6.5221,-6.5221}
Activity(exp=4):   {-6.5221,-6.5221}

Binding mode 1:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}

> Initial optimization (component0-1-f0).
>>  Starting new optimization: component0-1-f0. (2021-05-22 07:15:17.077).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[15,16,17,18]},{"h":[19,20,21,22]},{"h":[23,24,25]},{"h":[26,27]},{"h":[28,29]}],"bindingModeInteractions":[{}],"bindingModes":[{"mononucleotide":[],"activity":[[0,1,2,3],[4,5,6,7],[8,9,10],[11,12],[13,14]]},{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 5.258840200877299
gradient      = {-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000}
gradient norm = 1.0508558587174843E-4
Starting Function Value: 5.258840200877299
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    5.258840185850437    0.000281877696794    2.682363089624208    0.000095352392971
         2            5    5.258840117276647    0.000982932238824    5.000000000000000    0.000103553176034
         3            6    5.258831702144668    0.164186718259613    1.000000000000000    0.001791091732887
         4            7    5.258819168578869    0.284482876597563    1.000000000000000    0.003201360567622
         5            8    5.258774631506808    1.102245991455320    1.000000000000000    0.006293547025440
         6            9    5.258675841393114    2.612931538787008    1.000000000000000    0.010317786599107
         7           10    5.258452809328825    6.266260022310130    1.000000000000000    0.015160886241525
         8           11    5.258089794439004   11.036688913550213    1.000000000000000    0.017332931080597
         9           13    5.258023226372461    3.012220535091698    0.226329083838411    0.018093716023094
        10           14    5.257698971769224   10.205114815451880    1.000000000000000    0.010961049547347
        11           15    5.257587990900769    2.530854790775075    1.000000000000000    0.002952369197704
        12           16    5.257575746776673    1.124690069613388    1.000000000000000    0.000335534482697
        13           17    5.257575379181535    0.487058571494216    1.000000000000000    0.000090128006027
        14           18    5.257575376730845    0.054624340346018    1.000000000000000    0.000075556680542
        15           19    5.257575372037372    0.015638931226227    1.000000000000000    0.000002767823055
        16           20    5.257575372028012    0.000686381685266    1.000000000000000    0.000000523819420
        17           21    5.257575372027906    0.000686381685266    1.000000000000000    0.000000083855629
Convergence criteria met.
After: gradient norm = 8.385562902127627E-8
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {-0.0000,-0.0000,0.0000,0.0000}

Count Table 1:
---------------
h:                 {-0.0000,-0.0000,0.0000,0.0000}

Count Table 2:
---------------
h:                 {-0.0000,0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}

Suggested variations:
key=0;0;0, description = Initial model.
> Optimizing variation "Initial model." (component0-2-variation0).
>>  Starting new optimization: component0-2-variation0. (2021-05-22 07:15:21.104).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[15,16,17,18]},{"h":[19,20,21,22]},{"h":[23,24,25]},{"h":[26,27]},{"h":[28,29]}],"bindingModeInteractions":[{}],"bindingModes":[{"mononucleotide":[],"activity":[[0,1,2,3],[4,5,6,7],[8,9,10],[11,12],[13,14]]},{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 5.257575372027906
gradient      = {-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000}
gradient norm = 8.385562902168628E-8
Already at minimum!
After: gradient norm = 8.385562902168628E-8
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {-0.0000,-0.0000,0.0000,0.0000}

Count Table 1:
---------------
h:                 {-0.0000,-0.0000,0.0000,0.0000}

Count Table 2:
---------------
h:                 {-0.0000,0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}

  The Likelihood DID NOT improve. Discarding fit component0-2-variation0.
> No varitions possible for Binding mode 0.
> Optimizing the full model (component0-4-all).
>>  Starting new optimization: component0-4-all. (2021-05-22 07:15:21.266).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[15,16,17,18]},{"h":[19,20,21,22]},{"h":[23,24,25]},{"h":[26,27]},{"h":[28,29]}],"bindingModeInteractions":[{}],"bindingModes":[{"mononucleotide":[],"activity":[[0,1,2,3],[4,5,6,7],[8,9,10],[11,12],[13,14]]},{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 5.257575372027905
gradient      = {-0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000}
gradient norm = 8.385562902106475E-8
Already at minimum!
After: gradient norm = 8.385562902106475E-8
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {-0.0000,-0.0000,0.0000,0.0000}

Count Table 1:
---------------
h:                 {-0.0000,-0.0000,0.0000,0.0000}

Count Table 2:
---------------
h:                 {-0.0000,0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}


==================================
== Starts fiting Binding mode 1 ==
==================================
> Optimizing h (component1-0-h).
>>  Starting new optimization: component1-0-h. (2021-05-22 07:15:23.987).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[0,1,2,3]},{"h":[4,5,6,7]},{"h":[8,9,10]},{"h":[11,12]},{"h":[13,14]}],"bindingModeInteractions":[{}],"bindingModes":[{},{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 7.179905587574487
gradient      = {-0.2407,-0.2177,-0.1136,0.5721,-0.2269,-0.1956,-0.0905,0.5131,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000}
gradient norm = 0.898170625561755
Starting Function Value: 7.179905587574487
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            2    6.371811549495428    1.000000000000000    1.113374198109136    0.718477476095855
         2            3    4.734346338242012    5.407374096840854    1.000000000000000    0.253820742841365
         3            4    4.623935561355221    1.144153922671467    1.000000000000000    0.104485081749095
         4            5    4.602255027063590    0.393684468272018    1.000000000000000    0.036514428592046
         5            6    4.599629481910919    0.153221202391060    1.000000000000000    0.003056011927478
         6            7    4.599607520993157    0.013926707152032    1.000000000000000    0.000474365137864
         7            8    4.599606873637706    0.002330768438465    1.000000000000000    0.000103082681464
         8            9    4.599606839676333    0.000662682694066    1.000000000000000    0.000006159548032
         9           10    4.599606839604645    0.000037739463913    1.000000000000000    0.000002515841848
        10           11    4.599606839591776    0.000037739463913    1.000000000000000    0.000000127441746
Convergence criteria met.
After: gradient norm = 1.2744174596755667E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {2.6871,1.1385,-0.7363,-3.0893}

Count Table 1:
---------------
h:                 {2.2894,1.1041,-0.5461,-2.8474}

Count Table 2:
---------------
h:                 {-0.0000,-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {4.0414,4.0414,4.0414,4.0414}
Activity(exp=1):   {4.0160,4.0160,4.0160,4.0160}
Activity(exp=2):   {4.0160,4.0160,4.0160}
Activity(exp=3):   {4.0160,4.0160}
Activity(exp=4):   {4.0160,4.0160}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}

> Initial optimization (component1-1-f0).
>>  Starting new optimization: component1-1-f0. (2021-05-22 07:15:32.994).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[67,68,69,70]},{"h":[71,72,73,74]},{"h":[75,76,77]},{"h":[78,79]},{"h":[80,81]}],"bindingModeInteractions":[{}],"bindingModes":[{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51],"activity":[[52,53,54,55],[56,57,58,59],[60,61,62],[63,64],[65,66]]},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.59960683959178
gradient      = {-0.0320,0.0119,-0.0163,-0.0088,0.0090,0.0158,-0.0466,-0.0234,-0.0014,0.0183,0.0248,-0.0869,-0.0238,0.0147,-0.0388,0.0027,-0.1019,0.0205,0.0247,0.0115,0.0026,0.0129,0.0172,-0.0778,0.0035,0.0254,0.0195,-0.0935,0.0005,0.0208,0.0076,-0.0740,-0.0937,0.0238,0.0126,0.0121,0.0146,0.0003,0.0241,-0.0842,-0.0041,0.0055,0.0156,-0.0622,0.0081,0.0206,-0.0637,-0.0102,0.0049,-0.0526,-0.0005,0.0031,0.0000,-0.0089,-0.0079,-0.0020,0.0000,-0.0082,-0.0167,-0.0014,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000}
gradient norm = 0.2807754832361925
Starting Function Value: 4.59960683959178
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    4.585220328491374    0.096246642468549    0.342788627266239    0.262144114137500
         2            4    4.571392825334806    0.076483652225355    1.000000000000000    0.264730500761795
         3            5    4.454294928703026    1.296608053720558    1.000000000000000    0.528902402682481
         4            6    4.418233147031716    0.174871743823965    1.000000000000000    0.177358435630455
         5            7    4.402239707182408    0.382893405030854    1.000000000000000    0.076671705104793
         6            8    4.397706815866339    0.201543080278423    1.000000000000000    0.094081917081382
         7            9    4.382992251999465    0.436248745277553    1.000000000000000    0.091584287140324
         8           10    4.359729614030497    1.006874464840633    1.000000000000000    0.029727029599423
         9           11    4.355494616558189    0.341302896971599    1.000000000000000    0.025146330918814
        10           12    4.352130529784157    0.330661573307207    1.000000000000000    0.025333851712631
        11           13    4.347000494901533    0.777276221729967    1.000000000000000    0.033134383910591
        12           14    4.344731177728834    0.466775918055848    1.000000000000000    0.030199975084737
        13           15    4.342763015104795    0.158755170532617    1.000000000000000    0.018986473881987
        14           16    4.341750872559274    0.146776028126144    1.000000000000000    0.017322381274369
        15           17    4.340262899230308    0.269429368352579    1.000000000000000    0.015928382552438
        16           18    4.338024704798380    0.585371036490120    1.000000000000000    0.020678669518708
        17           19    4.336400795084735    0.495285505708018    1.000000000000000    0.018769538827268
        18           20    4.335297422730525    0.522731521455624    1.000000000000000    0.017416993364388
        19           21    4.334608238611507    0.389180776058969    1.000000000000000    0.013051118495601
        20           22    4.334099358568778    0.130087750992597    1.000000000000000    0.010268598637658
        21           23    4.333113607371740    0.371625922426176    1.000000000000000    0.018876473727269
        22           24    4.332402141292755    0.298119586666261    1.000000000000000    0.017803986324901
        23           25    4.330960761343996    0.664170999728336    1.000000000000000    0.011812428338343
        24           26    4.330278008931260    0.254015553830982    1.000000000000000    0.008616043088886
        25           27    4.329920081495432    0.112755839249704    1.000000000000000    0.006705527262480
        26           28    4.329670242187741    0.126302281943518    1.000000000000000    0.006681930719145
        27           29    4.329288399113212    0.181273002957343    1.000000000000000    0.009652015680920
        28           30    4.328955205692085    0.206838065654458    1.000000000000000    0.006384096012374
        29           31    4.328753468873677    0.158977357191451    1.000000000000000    0.005245852753854
        30           32    4.328493809311702    0.213538103132960    1.000000000000000    0.003882252577588
        31           33    4.328370382301996    0.117757000914932    1.000000000000000    0.004755677745339
        32           35    4.328322821209649    0.062131720419336    0.470673184473747    0.004506157785086
        33           36    4.328279408706489    0.040772663645822    1.000000000000000    0.002374304082216
        34           37    4.328246382252760    0.036143938426673    1.000000000000000    0.002489182167952
        35           38    4.328219712497656    0.040699303796533    1.000000000000000    0.003274925439362
        36           39    4.328188609230717    0.047620175483501    1.000000000000000    0.003272834320608
        37           40    4.328132648116360    0.094488220670320    1.000000000000000    0.002471518859321
        38           41    4.328066706473061    0.136283061759893    1.000000000000000    0.002454757133217
        39           42    4.328000058086950    0.203120375938646    1.000000000000000    0.002907856452009
        40           43    4.327938241678906    0.111393299610635    1.000000000000000    0.001711292706403
        41           44    4.327887169505016    0.097944530500441    1.000000000000000    0.001192615293627
        42           45    4.327854475242822    0.079118734226882    1.000000000000000    0.001237328140958
        43           46    4.327841678090008    0.139552151376603    1.000000000000000    0.003893171691722
        44           47    4.327812807548557    0.032649656619644    1.000000000000000    0.001680842973272
        45           48    4.327804828007072    0.020192511901707    1.000000000000000    0.000829898290896
        46           49    4.327798759185852    0.018108982875609    1.000000000000000    0.000644627851374
        47           50    4.327792635189402    0.028721733123927    1.000000000000000    0.000745012156141
        48           51    4.327783460092036    0.045038617535444    1.000000000000000    0.000784243565960
        49           52    4.327779188089998    0.044963076842748    1.000000000000000    0.001324731379940
        50           53    4.327775846348211    0.024550633070176    1.000000000000000    0.000479204309106
        51           54    4.327774750403020    0.011624391655361    1.000000000000000    0.000282270088032
        52           55    4.327773677465797    0.007795333203138    1.000000000000000    0.000277512534691
        53           56    4.327772528458246    0.011732087495439    1.000000000000000    0.000293158609687
        54           57    4.327770778112432    0.020601890163460    1.000000000000000    0.000292861262552
        55           58    4.327769485740583    0.050004934763884    1.000000000000000    0.000738483321469
        56           59    4.327767402493947    0.010357622530141    1.000000000000000    0.000309707817919
        57           60    4.327766712602823    0.006497950995006    1.000000000000000    0.000236302601617
        58           61    4.327766255372580    0.010210615946478    1.000000000000000    0.000151101586778
        59           62    4.327766023527947    0.007668879817877    1.000000000000000    0.000110352906693
        60           63    4.327765883075994    0.005272235380749    1.000000000000000    0.000093457181680
        61           64    4.327765788557989    0.003097268099350    1.000000000000000    0.000135837523769
        62           65    4.327765636402919    0.005556914815344    1.000000000000000    0.000147518612868
        63           66    4.327765415953544    0.009312706094948    1.000000000000000    0.000212402748383
        64           67    4.327765263032549    0.008499303873574    1.000000000000000    0.000089203426274
        65           68    4.327765175098885    0.004999590660504    1.000000000000000    0.000083852864862
        66           69    4.327765030889220    0.007412773907897    1.000000000000000    0.000172250704622
        67           70    4.327764782342713    0.014744044124366    1.000000000000000    0.000322681963339
        68           71    4.327764525270216    0.015813174697309    1.000000000000000    0.000402503335029
        69           72    4.327764107249338    0.025324998004226    1.000000000000000    0.000336745193194
        70           73    4.327763448490032    0.039427437087184    1.000000000000000    0.000214590149788
        71           74    4.327762511543608    0.059366308921120    1.000000000000000    0.000292663451098
        72           75    4.327761609795682    0.058238669524979    1.000000000000000    0.000605184230677
        73           76    4.327760572249302    0.062910020652168    1.000000000000000    0.000827999381992
        74           77    4.327758886156325    0.095928424979536    1.000000000000000    0.000883778463743
        75           78    4.327753880770946    0.293135443289308    1.000000000000000    0.001076007709655
        76           79    4.327744223148477    0.604147987853931    1.000000000000000    0.000799722765652
        77           80    4.327729756981562    0.966719236408216    1.000000000000000    0.000697178434938
        78           81    4.327709972407397    1.283280925697541    1.000000000000000    0.001390330788054
        79           82    4.327686766532854    1.400789927652055    1.000000000000000    0.002307436184983
        80           83    4.327659359016474    1.591667952791110    1.000000000000000    0.002904258719851
        81           84    4.327622978278692    2.171079325719652    1.000000000000000    0.002358117031862
        82           85    4.327592097176026    3.171669038167698    1.000000000000000    0.002578584452844
        83           86    4.327565536764620    1.095380618342105    1.000000000000000    0.000844023483775
        84           87    4.327554938612847    0.029569325456883    1.000000000000000    0.001298327683806
        85           88    4.327544232711822    0.278041258948696    1.000000000000000    0.001572226270577
        86           89    4.327532599018017    0.722363336620085    1.000000000000000    0.001184898408415
        87           90    4.327521184937787    1.171334814868767    1.000000000000000    0.000454653138137
        88           91    4.327517482582386    0.472385409168820    1.000000000000000    0.000542279505015
        89           92    4.327515058179725    0.215842653800347    1.000000000000000    0.000822015948979
        90           93    4.327512490143279    0.104106547128509    1.000000000000000    0.000858536229912
        91           94    4.327509283395542    0.101799065580414    1.000000000000000    0.000401014379167
        92           95    4.327508322334181    0.017549012430496    1.000000000000000    0.000156426293481
        93           96    4.327507987678525    0.021814291295471    1.000000000000000    0.000203696319046
        94           97    4.327507673938785    0.011663555835485    1.000000000000000    0.000267640298882
        95           98    4.327507363516786    0.029506101965360    1.000000000000000    0.000246603283195
        96           99    4.327507182943874    0.061381017881679    1.000000000000000    0.000109596735043
        97          100    4.327507139795645    0.007733136147464    1.000000000000000    0.000035872793900
        98          101    4.327507125812858    0.003762758633661    1.000000000000000    0.000045261514870
        99          102    4.327507113290675    0.001319520592652    1.000000000000000    0.000056359849519
       100          103    4.327507097954371    0.002818122316205    1.000000000000000    0.000051490885948
       101          104    4.327507082645912    0.004211359505908    1.000000000000000    0.000031495749140
       102          105    4.327507077422561    0.001668114089796    1.000000000000000    0.000019101885888
       103          106    4.327507076282396    0.000658238668414    1.000000000000000    0.000007767581095
       104          107    4.327507075977792    0.000698762965202    1.000000000000000    0.000007112415724
       105          108    4.327507075949031    0.001516177236876    1.000000000000000    0.000022152658385
       106          109    4.327507075578326    0.002232562808774    1.000000000000000    0.000005246078562
       107          110    4.327507075478773    0.000439616226643    1.000000000000000    0.000003766001120
       108          111    4.327507075303315    0.000946433700774    1.000000000000000    0.000007272889092
       109          112    4.327507075244024    0.000701900330211    1.000000000000000    0.000003192503871
       110          113    4.327507075195907    0.000199962555338    1.000000000000000    0.000002561457016
       111          114    4.327507075168356    0.000379984359940    1.000000000000000    0.000001213044334
       112          115    4.327507075158843    0.000379984359940    1.000000000000000    0.000000628780078
Convergence criteria met.
After: gradient norm = 6.287800776085914E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {2.9702,0.6016,-1.1394,-2.4324}

Count Table 1:
---------------
h:                 {2.3146,1.6854,-1.3784,-2.6217}

Count Table 2:
---------------
h:                 {-0.0000,-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-0.5572,-0.7732,-0.5802,-0.5718,-0.1347,-1.1806,-0.5298,-0.6371,-0.4298,-1.2692,-1.5186,0.7353,-0.4204,-1.6366,0.4921,-0.9174,1.1525,-1.3427,-1.3708,-0.9213,-1.1909,-0.8108,-1.0806,0.6001,-0.4051,-1.9655,-1.0675,0.9558,-0.8223,-2.0037,-0.2070,0.5506,1.2336,-1.4862,-0.8134,-1.4163,-1.5423,-0.0573,-1.6777,0.7950,-0.7272,-1.4026,0.0008,-0.3533,-0.0969,-1.4440,-0.2279,-0.7134,-0.9428,-0.3431,-0.5980,-0.5983}
Activity(exp=0):   {0.0000,2.3740,-0.3724,-2.5337}
Activity(exp=1):   {0.0000,0.1649,1.0118,-3.1267}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}

Suggested variations:
key=13;7;0, description = Initial model.
> Optimizing variation "Initial model." (component1-2-variation0).
>>  Starting new optimization: component1-2-variation0. (2021-05-22 07:18:02.474).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[67,68,69,70]},{"h":[71,72,73,74]},{"h":[75,76,77]},{"h":[78,79]},{"h":[80,81]}],"bindingModeInteractions":[{}],"bindingModes":[{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51],"activity":[[52,53,54,55],[56,57,58,59],[60,61,62],[63,64],[65,66]]},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.327507075158843
gradient      = {-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 6.28780077607947E-7
Already at minimum!
After: gradient norm = 6.28780077607947E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {2.9702,0.6016,-1.1394,-2.4324}

Count Table 1:
---------------
h:                 {2.3146,1.6854,-1.3784,-2.6217}

Count Table 2:
---------------
h:                 {-0.0000,-0.0000,0.0000}

Count Table 3:
---------------
h:                 {-0.0000,0.0000}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=1):   {-0.0000,-0.0000,-0.0000,-0.0000}
Activity(exp=2):   {-0.0000,-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-0.5572,-0.7732,-0.5802,-0.5718,-0.1347,-1.1806,-0.5298,-0.6371,-0.4298,-1.2692,-1.5186,0.7353,-0.4204,-1.6366,0.4921,-0.9174,1.1525,-1.3427,-1.3708,-0.9213,-1.1909,-0.8108,-1.0806,0.6001,-0.4051,-1.9655,-1.0675,0.9558,-0.8223,-2.0037,-0.2070,0.5506,1.2336,-1.4862,-0.8134,-1.4163,-1.5423,-0.0573,-1.6777,0.7950,-0.7272,-1.4026,0.0008,-0.3533,-0.0969,-1.4440,-0.2279,-0.7134,-0.9428,-0.3431,-0.5980,-0.5983}
Activity(exp=0):   {0.0000,2.3740,-0.3724,-2.5337}
Activity(exp=1):   {0.0000,0.1649,1.0118,-3.1267}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}

  The Likelihood DID NOT improve. Discarding fit component1-2-variation0.
> No varitions possible for Binding mode 1.
> Optimizing the full model (component1-4-all).
>>  Starting new optimization: component1-4-all. (2021-05-22 07:18:03.809).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[82,83,84,85]},{"h":[86,87,88,89]},{"h":[90,91,92]},{"h":[93,94]},{"h":[95,96]}],"bindingModeInteractions":[{}],"bindingModes":[{"mononucleotide":[],"activity":[[0,1,2,3],[4,5,6,7],[8,9,10],[11,12],[13,14]]},{"mononucleotide":[15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66],"activity":[[67,68,69,70],[71,72,73,74],[75,76,77],[78,79],[80,81]]},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.327507075158843
gradient      = {-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000}
gradient norm = 1.6719728541766727E-5
Starting Function Value: 4.327507075158843
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    4.327507065567155    0.001184648660213   70.853342938781180    0.000069192948702
         2            5    4.327507062642200    0.000348897170009    0.323158707864179    0.000103331121462
         3            6    4.327507058927418    0.000223790807391    1.000000000000000    0.000084460931873
         4            7    4.327507049941021    0.001236826294011    1.000000000000000    0.000027159756938
         5            8    4.327507048324417    0.000228757591786    1.000000000000000    0.000028957635836
         6            9    4.327507036091389    0.001987018729880    1.000000000000000    0.000055939272868
         7           10    4.327507028995169    0.001516260476556    1.000000000000000    0.000086371736569
         8           11    4.327507021600794    0.000954708112981    1.000000000000000    0.000043088497237
         9           12    4.327507017388685    0.000323927043913    1.000000000000000    0.000029056966511
        10           13    4.327507013949832    0.000316438325452    1.000000000000000    0.000042624520480
        11           14    4.327507007265833    0.000844654314982    1.000000000000000    0.000061854069373
        12           15    4.327506995998497    0.001920336506452    1.000000000000000    0.000070654885230
        13           16    4.327506994045457    0.004194301360992    1.000000000000000    0.000143598285367
        14           17    4.327506977450010    0.000318502473985    1.000000000000000    0.000047568362863
        15           18    4.327506970730386    0.000524699610812    1.000000000000000    0.000037506018075
        16           19    4.327506961483081    0.001447775373037    1.000000000000000    0.000067060812379
        17           20    4.327506947382709    0.002598317970890    1.000000000000000    0.000093553632767
        18           21    4.327506919199165    0.005328463818211    1.000000000000000    0.000103558576653
        19           22    4.327506862369199    0.010637931238720    1.000000000000000    0.000117177256108
        20           23    4.327506857082946    0.021622354298243    1.000000000000000    0.000210752266726
        21           24    4.327506772378117    0.002207412126750    1.000000000000000    0.000072340962594
        22           25    4.327506748492906    0.001381608731545    1.000000000000000    0.000048133048350
        23           26    4.327506720484701    0.002915805487457    1.000000000000000    0.000080703248542
        24           27    4.327506678173748    0.008029330921672    1.000000000000000    0.000118216776743
        25           28    4.327506599141876    0.016801740132345    1.000000000000000    0.000136707705898
        26           30    4.327506551227615    0.015237167163230    0.475874830509453    0.000225990751182
        27           31    4.327506459123808    0.019178128832839    1.000000000000000    0.000110481883052
        28           32    4.327506391885891    0.012554355432671    1.000000000000000    0.000096628870682
        29           33    4.327506319733296    0.011709736004492    1.000000000000000    0.000129832826829
        30           34    4.327506153463650    0.028100675096052    1.000000000000000    0.000170075585160
        31           35    4.327505854778138    0.069243446659645    1.000000000000000    0.000299641816425
        32           36    4.327505420778026    0.095763392614840    1.000000000000000    0.000228607059545
        33           37    4.327504938626604    0.074211845660113    1.000000000000000    0.000179305725507
        34           38    4.327504119886578    0.139964408910772    1.000000000000000    0.000227065051687
        35           39    4.327503530454749    0.165530257953853    1.000000000000000    0.000492967208108
        36           40    4.327502659283067    0.132997076740760    1.000000000000000    0.000346676794793
        37           41    4.327501292501743    0.229971707805832    1.000000000000000    0.000286126320444
        38           42    4.327499927315101    0.272504873777186    1.000000000000000    0.000363813669308
        39           43    4.327498017402765    0.425715745429624    1.000000000000000    0.000556644165254
        40           44    4.327495392997100    0.565463211338841    1.000000000000000    0.000448202426129
        41           45    4.327491803274887    0.664500786906111    1.000000000000000    0.000458105665588
        42           46    4.327486121600686    1.127860674221650    1.000000000000000    0.000403746901454
        43           47    4.327482770764377    0.744089936705294    1.000000000000000    0.000278106087985
        44           48    4.327481780736561    0.233204820216974    1.000000000000000    0.000324100750477
        45           49    4.327481457977386    0.065593572614814    1.000000000000000    0.000119870682399
        46           50    4.327481382771407    0.048821062638636    1.000000000000000    0.000085905784506
        47           51    4.327481280949358    0.012963370611806    1.000000000000000    0.000075385431672
        48           52    4.327481158163863    0.038400489987125    1.000000000000000    0.000073468992863
        49           53    4.327481087795147    0.071176956688724    1.000000000000000    0.000134937533531
        50           54    4.327481002118438    0.034193917610015    1.000000000000000    0.000043397226646
        51           55    4.327480981047549    0.002139123341140    1.000000000000000    0.000031514962131
        52           56    4.327480956883135    0.004298256615477    1.000000000000000    0.000022693849356
        53           57    4.327480947574510    0.002317705447007    1.000000000000000    0.000023136730913
        54           58    4.327480943586693    0.002611760826163    1.000000000000000    0.000011320691079
        55           59    4.327480942129165    0.001214265051434    1.000000000000000    0.000007922820603
        56           60    4.327480940000193    0.001706866601996    1.000000000000000    0.000007848766745
        57           61    4.327480938675621    0.000961228542146    1.000000000000000    0.000012257587192
        58           62    4.327480937574454    0.000487855788421    1.000000000000000    0.000004944748991
        59           63    4.327480937155145    0.000531035661710    1.000000000000000    0.000003262694070
        60           64    4.327480936914646    0.000199382227070    1.000000000000000    0.000003146941356
        61           65    4.327480936762821    0.000317359397148    1.000000000000000    0.000006213402315
        62           66    4.327480936535246    0.000138373772632    1.000000000000000    0.000002089678014
        63           67    4.327480936454324    0.000195522813552    1.000000000000000    0.000001704608433
        64           68    4.327480936373932    0.000131241967638    1.000000000000000    0.000001684702269
        65           69    4.327480936291222    0.000210099140930    1.000000000000000    0.000001321327404
        66           70    4.327480936290189    0.000986530286243    1.000000000000000    0.000003417101147
        67           71    4.327480936265271    0.000986530286243    1.000000000000000    0.000000633748618
Convergence criteria met.
After: gradient norm = 6.337486181131282E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {0.9212,0.6331,-0.0825,-1.4717}

Count Table 1:
---------------
h:                 {0.7784,1.0554,-0.1517,-1.6822}

Count Table 2:
---------------
h:                 {-0.0000,0.0000,-0.0000}

Count Table 3:
---------------
h:                 {0.0000,-0.0000}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-2.0840,-1.0262,0.0959}
Activity(exp=1):   {-0.0000,-0.9063,-1.8588,0.2872}
Activity(exp=2):   {0.0000,0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-0.6239,-0.8398,-0.6469,-0.6385,-0.2015,-1.2473,-0.5965,-0.7038,-0.4966,-1.3359,-1.5851,0.6684,-0.4872,-1.7029,0.4252,-0.9842,1.0855,-1.4092,-1.4374,-0.9881,-1.2578,-0.8771,-1.1473,0.5331,-0.4718,-2.0319,-1.1341,0.8887,-0.8891,-2.0699,-0.2738,0.4837,1.1661,-1.5522,-0.8802,-1.4828,-1.6088,-0.1242,-1.7441,0.7280,-0.7939,-1.4692,-0.0659,-0.4201,-0.1637,-1.5106,-0.2947,-0.7801,-1.0095,-0.4098,-0.6647,-0.6650}
Activity(exp=0):   {0.0000,1.1629,-0.5280,-1.5676}
Activity(exp=1):   {0.0000,0.1279,0.0250,-1.9694}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}


==================================
== Starts fiting Binding mode 2 ==
==================================
> Optimizing h (component2-0-h).
>>  Starting new optimization: component2-0-h. (2021-05-22 07:19:32.572).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[0,1,2,3]},{"h":[4,5,6,7]},{"h":[8,9,10]},{"h":[11,12]},{"h":[13,14]}],"bindingModeInteractions":[{}],"bindingModes":[{},{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.74300285003531
gradient      = {-0.1195,-0.0827,0.0010,0.2013,-0.1104,0.0334,-0.0241,0.1011,-0.0000,0.0000,-0.0000,-0.2423,0.2423,-0.0000,0.0000}
gradient norm = 0.45077878657736964
Starting Function Value: 4.74300285003531
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            2    4.459737642997841    1.000000000000000    2.218383006868413    0.174977264618199
         2            3    4.380250253499773    0.665280833860161    1.000000000000000    0.101886852320864
         3            4    4.346276963215534    0.669998934186253    1.000000000000000    0.019245356175562
         4            5    4.344836513601894    0.138589607746642    1.000000000000000    0.007081776041067
         5            6    4.344664377377103    0.069957639562382    1.000000000000000    0.003274261642817
         6            7    4.344640847916474    0.016023953893013    1.000000000000000    0.000332083413237
         7            8    4.344640630800064    0.001556038375237    1.000000000000000    0.000061897341607
         8            9    4.344640626291134    0.000172537327982    1.000000000000000    0.000004266275700
         9           10    4.344640626262411    0.000013577486110    1.000000000000000    0.000000775589354
        10           11    4.344640626260928    0.000013577486110    1.000000000000000    0.000000213648429
Convergence criteria met.
After: gradient norm = 2.136484291976449E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {1.9085,1.0455,-0.4102,-2.5438}

Count Table 1:
---------------
h:                 {1.6904,1.1228,-0.3772,-2.4361}

Count Table 2:
---------------
h:                 {0.0000,-0.0000,0.0000}

Count Table 3:
---------------
h:                 {0.5311,-0.5311}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-2.0840,-1.0262,0.0959}
Activity(exp=1):   {-0.0000,-0.9063,-1.8588,0.2872}
Activity(exp=2):   {0.0000,0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-0.6239,-0.8398,-0.6469,-0.6385,-0.2015,-1.2473,-0.5965,-0.7038,-0.4966,-1.3359,-1.5851,0.6684,-0.4872,-1.7029,0.4252,-0.9842,1.0855,-1.4092,-1.4374,-0.9881,-1.2578,-0.8771,-1.1473,0.5331,-0.4718,-2.0319,-1.1341,0.8887,-0.8891,-2.0699,-0.2738,0.4837,1.1661,-1.5522,-0.8802,-1.4828,-1.6088,-0.1242,-1.7441,0.7280,-0.7939,-1.4692,-0.0659,-0.4201,-0.1637,-1.5106,-0.2947,-0.7801,-1.0095,-0.4098,-0.6647,-0.6650}
Activity(exp=0):   {0.0000,1.1629,-0.5280,-1.5676}
Activity(exp=1):   {0.0000,0.1279,0.0250,-1.9694}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.2803,-1.6173,-0.7405,0.3695}
Activity(exp=1):   {0.2319,-0.6592,-1.5806,0.5114}
Activity(exp=2):   {0.2233,0.2233,0.2233}
Activity(exp=3):   {0.2233,0.2233}
Activity(exp=4):   {0.2233,0.2233}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}

> Initial optimization (component2-1-f0).
>>  Starting new optimization: component2-1-f0. (2021-05-22 07:19:46.371).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[47,48,49,50]},{"h":[51,52,53,54]},{"h":[55,56,57]},{"h":[58,59]},{"h":[60,61]}],"bindingModeInteractions":[{}],"bindingModes":[{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31],"activity":[[32,33,34,35],[36,37,38,39],[40,41,42],[43,44],[45,46]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.344640626260927
gradient      = {0.0055,0.0149,0.0136,0.0052,0.0039,0.0104,0.0082,0.0165,0.0076,0.0115,0.0150,0.0051,0.0055,0.0090,0.0179,0.0067,0.0055,0.0150,0.0140,0.0046,0.0058,0.0138,0.0074,0.0121,0.0066,0.0108,0.0177,0.0039,0.0068,0.0149,0.0131,0.0044,0.0000,0.0049,0.0116,0.0089,0.0000,0.0047,0.0069,0.0044,0.0000,0.0000,0.0000,0.0000,-0.0023,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000}
gradient norm = 0.06344555936947728
Starting Function Value: 4.344640626260927
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    4.341826720795345    0.112150780436244    1.767669503599616    0.060168631895314
         2            4    4.339491457107683    0.052570567642542    1.000000000000000    0.045100811116459
         3            5    4.330012672044783    0.398274805416094    1.000000000000000    0.060647053902642
         4            6    4.323764911208339    0.339330503556386    1.000000000000000    0.077546206980164
         5            7    4.311855009571737    0.794743197662943    1.000000000000000    0.090142801699090
         6            8    4.303124174039800    0.588343982959797    1.000000000000000    0.060329244046174
         7            9    4.296069347685180    0.590875428763781    1.000000000000000    0.022137450766597
         8           10    4.293009651232248    0.445303751304196    1.000000000000000    0.022872278263159
         9           11    4.288000920402066    0.737552020109057    1.000000000000000    0.016418507563978
        10           12    4.284209036723306    1.005068165505191    1.000000000000000    0.032343136343305
        11           13    4.282135875755840    0.302424339574869    1.000000000000000    0.017759587616022
        12           14    4.281372079426341    0.082729446894696    1.000000000000000    0.010373630499101
        13           15    4.280273078214087    0.160653678352403    1.000000000000000    0.013893999675281
        14           16    4.278770242279935    0.395508605446083    1.000000000000000    0.027782616428216
        15           17    4.277336346669403    0.402765600981475    1.000000000000000    0.024906446751388
        16           18    4.276063519846809    0.580153883260067    1.000000000000000    0.025954518932535
        17           19    4.274879514700918    0.248424787134108    1.000000000000000    0.008446031568724
        18           20    4.274368468551322    0.261062655963749    1.000000000000000    0.008503518690509
        19           21    4.273302041358278    0.575681264354550    1.000000000000000    0.009659100944846
        20           23    4.272870097617734    0.361067712124193    0.466691009886969    0.013285704077233
        21           24    4.272418438897325    0.351030203071808    1.000000000000000    0.009545149647554
        22           25    4.272258264185916    0.064025974888119    1.000000000000000    0.005323712016787
        23           26    4.272145805741697    0.097043593790830    1.000000000000000    0.005196245049549
        24           27    4.271828478148762    0.417869129027423    1.000000000000000    0.005683026307207
        25           28    4.271692491819304    0.369182926558130    1.000000000000000    0.008125338468498
        26           29    4.271514298900085    0.216893458801242    1.000000000000000    0.003020153490938
        27           30    4.271444187567210    0.154490716241910    1.000000000000000    0.002041484035024
        28           31    4.271395739669655    0.108537628363934    1.000000000000000    0.002975163532341
        29           32    4.271309891347133    0.192529405928435    1.000000000000000    0.003417769637202
        30           33    4.271234465412446    0.202329469641575    1.000000000000000    0.004971853259102
        31           34    4.271167989048315    0.091832332153661    1.000000000000000    0.001641236129531
        32           35    4.271140091843718    0.063994554424979    1.000000000000000    0.001634523646166
        33           36    4.271112998524107    0.041948524328951    1.000000000000000    0.002082005389642
        34           37    4.271083174732715    0.095323222124701    1.000000000000000    0.002397098005561
        35           38    4.271056525503496    0.150502332276087    1.000000000000000    0.001617539151930
        36           39    4.271039758286321    0.160700394530438    1.000000000000000    0.001423124046929
        37           40    4.271029060146922    0.115054330855154    1.000000000000000    0.001273367892557
        38           41    4.271020259879719    0.058559994429925    1.000000000000000    0.001281322744558
        39           42    4.270981966222587    0.237448503359029    1.000000000000000    0.001191925818213
        40           43    4.270953418931616    0.180706397904013    1.000000000000000    0.000863060197591
        41           44    4.270926981079520    0.215157831956766    1.000000000000000    0.000855514874516
        42           46    4.270923534390069    0.040805755325136    0.178953151812880    0.000985586541254
        43           47    4.270915978911800    0.070918238938122    1.000000000000000    0.000620032997822
        44           48    4.270911044551639    0.043447928159355    1.000000000000000    0.000478162440582
        45           49    4.270904844488504    0.075034313411714    1.000000000000000    0.000385742374060
        46           50    4.270899659705531    0.072055969816185    1.000000000000000    0.000391142006743
        47           51    4.270894003028752    0.071843875614730    1.000000000000000    0.000419802397277
        48           52    4.270887899763406    0.070589491323932    1.000000000000000    0.000461136600968
        49           53    4.270881738620684    0.102572110181125    1.000000000000000    0.000955112471243
        50           54    4.270876214166245    0.051035818937322    1.000000000000000    0.000486253800225
        51           55    4.270871738464801    0.065481976269022    1.000000000000000    0.000439235949006
        52           56    4.270870200850790    0.020179255259023    1.000000000000000    0.000439067553511
        53           57    4.270865679632541    0.101931768158469    1.000000000000000    0.000321862749729
        54           58    4.270863206936171    0.086906050962336    1.000000000000000    0.000264037078207
        55           59    4.270861746666331    0.076432940371356    1.000000000000000    0.000223051894419
        56           60    4.270860982755477    0.036311300613290    1.000000000000000    0.000184951570541
        57           61    4.270859816580110    0.039799708481340    1.000000000000000    0.000206103276131
        58           62    4.270857676624018    0.075799087570670    1.000000000000000    0.000241415359300
        59           63    4.270854909264015    0.115378699512739    1.000000000000000    0.000211884374205
        60           64    4.270851932409234    0.113631674599057    1.000000000000000    0.000182597450071
        61           65    4.270848321012807    0.139540714373516    1.000000000000000    0.000168623031842
        62           66    4.270845588805880    0.106529492029775    1.000000000000000    0.000235884914166
        63           67    4.270842574718248    0.121744977434752    1.000000000000000    0.000263843757122
        64           68    4.270840798862011    0.073050993953952    1.000000000000000    0.000170646347935
        65           69    4.270840162449614    0.017327483600402    1.000000000000000    0.000086970692193
        66           70    4.270839828298628    0.009085327376264    1.000000000000000    0.000102039737903
        67           71    4.270839237780545    0.019086477164789    1.000000000000000    0.000129105588281
        68           72    4.270837901540978    0.057689837520827    1.000000000000000    0.000154758445818
        69           73    4.270836079135383    0.098498725674060    1.000000000000000    0.000215190333101
        70           74    4.270834979182477    0.082641463977233    1.000000000000000    0.000085782295493
        71           75    4.270834686754659    0.023793526928729    1.000000000000000    0.000053503135720
        72           76    4.270834556085624    0.008590595834096    1.000000000000000    0.000054477236040
        73           77    4.270834341248248    0.013106246600258    1.000000000000000    0.000066384070921
        74           78    4.270833885812803    0.029687627134647    1.000000000000000    0.000069047881228
        75           79    4.270833271374127    0.047340362032943    1.000000000000000    0.000069700033689
        76           80    4.270832781960376    0.059511146738673    1.000000000000000    0.000112374926639
        77           81    4.270832503685740    0.021384345579603    1.000000000000000    0.000050278381899
        78           82    4.270832320489286    0.022137878434415    1.000000000000000    0.000044131616258
        79           83    4.270832220135412    0.009701883339051    1.000000000000000    0.000040507318978
        80           84    4.270832023096705    0.021658950069998    1.000000000000000    0.000050356598424
        81           85    4.270831872528628    0.027145499983114    1.000000000000000    0.000041004889403
        82           86    4.270831732323716    0.029462257351170    1.000000000000000    0.000049555384164
        83           87    4.270831567075589    0.034794821357713    1.000000000000000    0.000044918906413
        84           88    4.270831453050281    0.018595369140656    1.000000000000000    0.000045247814669
        85           89    4.270831347524744    0.015542910231242    1.000000000000000    0.000043029167150
        86           90    4.270831201258190    0.026534220953504    1.000000000000000    0.000051734027837
        87           91    4.270830943701817    0.047193480559863    1.000000000000000    0.000066317264363
        88           92    4.270830588421583    0.067140032457823    1.000000000000000    0.000069519476771
        89           93    4.270830281991589    0.058240792784963    1.000000000000000    0.000051972719513
        90           94    4.270830113876328    0.044657690234216    1.000000000000000    0.000026625784857
        91           95    4.270830049326253    0.025000280368290    1.000000000000000    0.000034966083392
        92           96    4.270829966998444    0.028001234927397    1.000000000000000    0.000048050270175
        93           97    4.270829766015003    0.051542172815882    1.000000000000000    0.000072264479551
        94           98    4.270829404363975    0.085916553195512    1.000000000000000    0.000079245739512
        95           99    4.270829106161688    0.101384476386961    1.000000000000000    0.000166941147617
        96          100    4.270828916291708    0.034518073214182    1.000000000000000    0.000064066224348
        97          101    4.270828839795388    0.046429826486185    1.000000000000000    0.000023009969429
        98          102    4.270828832335814    0.010301009229866    1.000000000000000    0.000012426902747
        99          103    4.270828825386765    0.011802850296094    1.000000000000000    0.000010963236330
       100          104    4.270828819972761    0.004431648947744    1.000000000000000    0.000016114743789
       101          105    4.270828803146944    0.008861909226298    1.000000000000000    0.000027666995459
       102          106    4.270828774091392    0.011244548061742    1.000000000000000    0.000038726778974
       103          107    4.270828697286390    0.027411766643466    1.000000000000000    0.000053229580599
       104          108    4.270828536129586    0.057338031296044    1.000000000000000    0.000069043992662
       105          109    4.270828280843546    0.097725057002184    1.000000000000000    0.000076480776695
       106          111    4.270828211166562    0.039282018008998    0.281944811171044    0.000111360865024
       107          112    4.270828046654011    0.058606620261726    1.000000000000000    0.000038496580220
       108          113    4.270828000817215    0.019298310747848    1.000000000000000    0.000011975223746
       109          114    4.270827994553018    0.006926251746933    1.000000000000000    0.000007710176982
       110          115    4.270827989032308    0.006160261396914    1.000000000000000    0.000010515353194
       111          116    4.270827979482272    0.005696423978607    1.000000000000000    0.000015131174398
       112          117    4.270827955486283    0.008419695152206    1.000000000000000    0.000036203685213
       113          118    4.270827912365580    0.016556702030853    1.000000000000000    0.000040389724246
       114          119    4.270827785454622    0.053895672140354    1.000000000000000    0.000061000843621
       115          120    4.270827542520379    0.119941704232796    1.000000000000000    0.000070008319005
       116          121    4.270827301491977    0.162961845719426    1.000000000000000    0.000076561023255
       117          122    4.270827229688146    0.101959397086970    1.000000000000000    0.000185965242749
       118          123    4.270827142137517    0.024722611430249    1.000000000000000    0.000045597926443
       119          124    4.270827132523668    0.021514571257285    1.000000000000000    0.000009102590528
       120          125    4.270827131537364    0.002070365270069    1.000000000000000    0.000006167427450
       121          126    4.270827130755389    0.001429361629946    1.000000000000000    0.000007156102688
       122          128    4.270827130386810    0.001127030104744    0.220572930355373    0.000013905077797
       123          129    4.270827129355141    0.001580967320327    1.000000000000000    0.000010151109450
       124          130    4.270827127451150    0.001758063804927    1.000000000000000    0.000008674725571
       125          131    4.270827120567123    0.005068325641627    1.000000000000000    0.000016784747891
       126          132    4.270827106015546    0.011253846203340    1.000000000000000    0.000034794034573
       127          133    4.270827071040171    0.023221137809177    1.000000000000000    0.000063949816985
       128          134    4.270827000433957    0.057114032303964    1.000000000000000    0.000103999661925
       129          135    4.270826856644137    0.094757205654107    1.000000000000000    0.000111088989707
       130          136    4.270826771970854    0.214350221124541    1.000000000000000    0.000289377380613
       131          137    4.270826564706384    0.025889619214880    1.000000000000000    0.000070046851839
       132          138    4.270826527074037    0.014567173046925    1.000000000000000    0.000029728574751
       133          139    4.270826520359839    0.009649756762323    1.000000000000000    0.000043097838005
       134          140    4.270826516329300    0.003590674877915    1.000000000000000    0.000010702174288
       135          141    4.270826515257524    0.001807898841710    1.000000000000000    0.000009055735341
       136          142    4.270826513830044    0.003212178163094    1.000000000000000    0.000007735294544
       137          144    4.270826513496460    0.000790540792350    0.236941408658695    0.000010218580034
       138          145    4.270826512888670    0.001071921788470    1.000000000000000    0.000008730839068
       139          146    4.270826511004517    0.003129108085751    1.000000000000000    0.000009191734241
       140          147    4.270826508197618    0.003626948422071    1.000000000000000    0.000016360559479
       141          148    4.270826503859647    0.005663238425756    1.000000000000000    0.000017734512840
       142          149    4.270826496983410    0.005320730184857    1.000000000000000    0.000020201577345
       143          150    4.270826480142620    0.010136913198876    1.000000000000000    0.000030696644226
       144          151    4.270826453512886    0.026246447360906    1.000000000000000    0.000048082647134
       145          152    4.270826437854109    0.030978906288467    1.000000000000000    0.000123957208256
       146          153    4.270826399557869    0.007607436907316    1.000000000000000    0.000044103750772
       147          154    4.270826377394417    0.012666290369176    1.000000000000000    0.000024719469816
       148          155    4.270826370633685    0.010611930453582    1.000000000000000    0.000016005817947
       149          156    4.270826366485911    0.008386584900585    1.000000000000000    0.000007622039130
       150          157    4.270826364317384    0.006558156829352    1.000000000000000    0.000008182130204
       151          158    4.270826361376332    0.004331638602872    1.000000000000000    0.000011501970208
       152          159    4.270826354276813    0.011115013731672    1.000000000000000    0.000017254499189
       153          161    4.270826348515475    0.006130608070832    0.484600720152093    0.000039690473830
       154          162    4.270826334562816    0.010726679473884    1.000000000000000    0.000032132088443
       155          163    4.270826294176652    0.028868852416492    1.000000000000000    0.000033254194293
       156          164    4.270826247325403    0.032018368973020    1.000000000000000    0.000049830589484
       157          165    4.270826178883755    0.065999757063838    1.000000000000000    0.000050791746219
       158          166    4.270826134433961    0.059744486637383    1.000000000000000    0.000075524076697
       159          167    4.270826098201237    0.010975420346503    1.000000000000000    0.000023985944213
       160          168    4.270826086195139    0.006078580447186    1.000000000000000    0.000016734991231
       161          169    4.270826082489090    0.004959120244941    1.000000000000000    0.000012626481621
       162          170    4.270826079976987    0.005280760353919    1.000000000000000    0.000014380845710
       163          171    4.270826078817318    0.006133499696793    1.000000000000000    0.000004584318470
       164          172    4.270826078412313    0.000572524229482    1.000000000000000    0.000005430817386
       165          173    4.270826076781123    0.002085105345519    1.000000000000000    0.000010127498686
       166          174    4.270826074191760    0.003004747287024    1.000000000000000    0.000014603559666
       167          175    4.270826065691064    0.008802696575286    1.000000000000000    0.000023414802155
       168          176    4.270826047328622    0.018548496760286    1.000000000000000    0.000035481124512
       169          177    4.270826004224091    0.042743718311223    1.000000000000000    0.000048928108377
       170          178    4.270825922325623    0.093144035628590    1.000000000000000    0.000083855460980
       171          179    4.270825799082790    0.128359625894037    1.000000000000000    0.000073985553179
       172          180    4.270825651498218    0.158126652204015    1.000000000000000    0.000078991082153
       173          181    4.270825573885751    0.080321347088634    1.000000000000000    0.000055958426892
       174          182    4.270825549329464    0.011154661362052    1.000000000000000    0.000022948015076
       175          183    4.270825542245729    0.012436140889118    1.000000000000000    0.000012949002319
       176          184    4.270825537259180    0.003580325661390    1.000000000000000    0.000009984618546
       177          185    4.270825533166666    0.010210529288118    1.000000000000000    0.000010477203866
       178          186    4.270825530584540    0.009666576028840    1.000000000000000    0.000008246004295
       179          187    4.270825529185681    0.006956878625406    1.000000000000000    0.000007464377936
       180          188    4.270825528583756    0.002463589052969    1.000000000000000    0.000003293302507
       181          189    4.270825528413250    0.002907253054636    1.000000000000000    0.000001513874972
       182          190    4.270825528370200    0.002907253054636    1.000000000000000    0.000001200203724
Convergence criteria met.
After: gradient norm = 1.2002037239130418E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {1.4049,0.7816,-0.2718,-1.9148}

Count Table 1:
---------------
h:                 {0.7888,1.0610,-0.1540,-1.6958}

Count Table 2:
---------------
h:                 {-0.0000,-0.0000,0.0000}

Count Table 3:
---------------
h:                 {0.1085,-0.1085}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-2.0840,-1.0262,0.0959}
Activity(exp=1):   {-0.0000,-0.9063,-1.8588,0.2872}
Activity(exp=2):   {0.0000,0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-0.6239,-0.8398,-0.6469,-0.6385,-0.2015,-1.2473,-0.5965,-0.7038,-0.4966,-1.3359,-1.5851,0.6684,-0.4872,-1.7029,0.4252,-0.9842,1.0855,-1.4092,-1.4374,-0.9881,-1.2578,-0.8771,-1.1473,0.5331,-0.4718,-2.0319,-1.1341,0.8887,-0.8891,-2.0699,-0.2738,0.4837,1.1661,-1.5522,-0.8802,-1.4828,-1.6088,-0.1242,-1.7441,0.7280,-0.7939,-1.4692,-0.0659,-0.4201,-0.1637,-1.5106,-0.2947,-0.7801,-1.0095,-0.4098,-0.6647,-0.6650}
Activity(exp=0):   {0.0000,1.1629,-0.5280,-1.5676}
Activity(exp=1):   {0.0000,0.1279,0.0250,-1.9694}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {-1.5381,-1.8859,-1.6653,-1.4158,-1.5924,-2.0998,-1.6921,-1.1283,-1.4518,-3.1657,-2.7359,0.8408,-1.6701,-3.1744,0.7649,-2.4330,3.3416,-4.1505,-3.3417,-2.3620,-2.4680,-0.0231,-2.6882,-1.3309,0.1018,-3.4665,-0.9837,-2.1617,-1.9464,-1.9813,-1.1316,-1.4458}
Activity(exp=0):   {0.0007,0.3464,-0.2833,0.2960}
Activity(exp=1):   {0.0006,-3.7447,-3.0320,-1.0702}
Activity(exp=2):   {0.0006,0.0006,0.0006}
Activity(exp=3):   {0.0006,0.9739}
Activity(exp=4):   {0.0006,0.0006}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}

Suggested variations:
key=8;5;0, description = Initial model.
> Optimizing variation "Initial model." (component2-2-variation0).
>>  Starting new optimization: component2-2-variation0. (2021-05-22 07:25:34.803).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[47,48,49,50]},{"h":[51,52,53,54]},{"h":[55,56,57]},{"h":[58,59]},{"h":[60,61]}],"bindingModeInteractions":[{}],"bindingModes":[{},{},{"mononucleotide":[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31],"activity":[[32,33,34,35],[36,37,38,39],[40,41,42],[43,44],[45,46]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.2708255283702
gradient      = {0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000}
gradient norm = 1.2002037239120296E-6
Already at minimum!
After: gradient norm = 1.2002037239120296E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {1.4049,0.7816,-0.2718,-1.9148}

Count Table 1:
---------------
h:                 {0.7888,1.0610,-0.1540,-1.6958}

Count Table 2:
---------------
h:                 {-0.0000,-0.0000,0.0000}

Count Table 3:
---------------
h:                 {0.1085,-0.1085}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-2.0840,-1.0262,0.0959}
Activity(exp=1):   {-0.0000,-0.9063,-1.8588,0.2872}
Activity(exp=2):   {0.0000,0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-0.6239,-0.8398,-0.6469,-0.6385,-0.2015,-1.2473,-0.5965,-0.7038,-0.4966,-1.3359,-1.5851,0.6684,-0.4872,-1.7029,0.4252,-0.9842,1.0855,-1.4092,-1.4374,-0.9881,-1.2578,-0.8771,-1.1473,0.5331,-0.4718,-2.0319,-1.1341,0.8887,-0.8891,-2.0699,-0.2738,0.4837,1.1661,-1.5522,-0.8802,-1.4828,-1.6088,-0.1242,-1.7441,0.7280,-0.7939,-1.4692,-0.0659,-0.4201,-0.1637,-1.5106,-0.2947,-0.7801,-1.0095,-0.4098,-0.6647,-0.6650}
Activity(exp=0):   {0.0000,1.1629,-0.5280,-1.5676}
Activity(exp=1):   {0.0000,0.1279,0.0250,-1.9694}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 2:
---------------
Mononucleotide:    {-1.5381,-1.8859,-1.6653,-1.4158,-1.5924,-2.0998,-1.6921,-1.1283,-1.4518,-3.1657,-2.7359,0.8408,-1.6701,-3.1744,0.7649,-2.4330,3.3416,-4.1505,-3.3417,-2.3620,-2.4680,-0.0231,-2.6882,-1.3309,0.1018,-3.4665,-0.9837,-2.1617,-1.9464,-1.9813,-1.1316,-1.4458}
Activity(exp=0):   {0.0007,0.3464,-0.2833,0.2960}
Activity(exp=1):   {0.0006,-3.7447,-3.0320,-1.0702}
Activity(exp=2):   {0.0006,0.0006,0.0006}
Activity(exp=3):   {0.0006,0.9739}
Activity(exp=4):   {0.0006,0.0006}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}

  The Likelihood DID NOT improve. Discarding fit component2-2-variation0.
> No varitions possible for Binding mode 2.
> Optimizing the full model (component2-4-all).
>>  Starting new optimization: component2-4-all. (2021-05-22 07:25:36.613).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[129,130,131,132]},{"h":[133,134,135,136]},{"h":[137,138,139]},{"h":[140,141]},{"h":[142,143]}],"bindingModeInteractions":[{}],"bindingModes":[{"mononucleotide":[],"activity":[[0,1,2,3],[4,5,6,7],[8,9,10],[11,12],[13,14]]},{"mononucleotide":[15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66],"activity":[[67,68,69,70],[71,72,73,74],[75,76,77],[78,79],[80,81]]},{"mononucleotide":[82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108,109,110,111,112,113],"activity":[[114,115,116,117],[118,119,120,121],[122,123,124],[125,126],[127,128]]},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.270825528370203
gradient      = {-0.0000,0.0003,0.0052,0.0070,-0.0000,0.0000,0.0001,0.0002,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0036,-0.0026,-0.0054,-0.0013,-0.0086,-0.0002,-0.0033,-0.0007,-0.0003,-0.0001,-0.0001,-0.0123,-0.0040,0.0018,-0.0092,-0.0015,-0.0145,0.0000,0.0002,0.0015,-0.0005,0.0059,0.0005,-0.0187,0.0050,-0.0004,0.0009,-0.0184,-0.0017,0.0002,0.0099,-0.0213,-0.0161,0.0008,0.0019,0.0005,0.0001,0.0032,-0.0005,-0.0156,0.0036,0.0005,-0.0095,-0.0074,-0.0084,-0.0006,-0.0040,0.0002,-0.0017,-0.0040,-0.0032,-0.0039,0.0000,-0.0003,-0.0052,-0.0070,0.0000,-0.0000,-0.0001,-0.0002,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,0.0000,-0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,0.0000,-0.0000,-0.0000,-0.0000,0.0000,0.0000,-0.0000,-0.0000,0.0000}
gradient norm = 0.053637861905429046
Starting Function Value: 4.270825528370203
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            3    4.270141717917859    0.024002646767312    0.447494473393282    0.028695308983454
         2            4    4.269811924379635    0.013437147958572    1.000000000000000    0.029384180315410
         3            5    4.264305804890814    0.365490808357601    1.000000000000000    0.045317953144058
         4            6    4.261551087851389    0.269825153057040    1.000000000000000    0.051820203060318
         5            7    4.260011897357575    0.256064804615316    1.000000000000000    0.022990014231626
         6            8    4.259537853899090    0.055486999123214    1.000000000000000    0.014150876959521
         7            9    4.259063420254973    0.085796484170698    1.000000000000000    0.021260159342489
         8           10    4.258545575128619    0.115995484026063    1.000000000000000    0.025976966183493
         9           11    4.257531489185545    0.242692720683123    1.000000000000000    0.024178504989114
        10           12    4.256487483412910    0.381557672394429    1.000000000000000    0.018679199044041
        11           13    4.255858421779538    0.151565113950820    1.000000000000000    0.008866300157223
        12           14    4.255549340782278    0.080245886738460    1.000000000000000    0.007485625157427
        13           15    4.255321859470072    0.077643593940970    1.000000000000000    0.008479469172721
        14           16    4.254913150958788    0.172362563102639    1.000000000000000    0.007909276268734
        15           18    4.254820786476346    0.070569699216869    0.245144801106462    0.010524642192899
        16           19    4.254620408874908    0.135045942905507    1.000000000000000    0.005515989186998
        17           20    4.254499314100809    0.089272147206623    1.000000000000000    0.004128389919842
        18           21    4.254328440511326    0.164777212564546    1.000000000000000    0.006143293865755
        19           22    4.254212908440866    0.188245277484773    1.000000000000000    0.010905283270406
        20           23    4.254060338498994    0.115738170693516    1.000000000000000    0.006224009295188
        21           24    4.253943819917844    0.084446397521103    1.000000000000000    0.004358822386160
        22           25    4.253842605362811    0.081424702941097    1.000000000000000    0.004731273454899
        23           26    4.253740986511532    0.088101591955188    1.000000000000000    0.005483728771779
        24           27    4.253589222362865    0.156993632352564    1.000000000000000    0.005655820119458
        25           28    4.253440579591538    0.236513480953460    1.000000000000000    0.008285675863460
        26           29    4.253279662751144    0.217509965993721    1.000000000000000    0.005219278257656
        27           30    4.253169975164941    0.054687697569447    1.000000000000000    0.004121741188530
        28           31    4.253083997776520    0.142589613713264    1.000000000000000    0.003183328665822
        29           32    4.253015834277589    0.062294577363116    1.000000000000000    0.004804656124492
        30           33    4.252940321324422    0.108196923944996    1.000000000000000    0.003352844914032
        31           34    4.252869643759905    0.083728372272609    1.000000000000000    0.002760384256519
        32           35    4.252787914888350    0.127717478541883    1.000000000000000    0.004398955942771
        33           36    4.252717633673025    0.094134627207087    1.000000000000000    0.004630389429777
        34           37    4.252630412128241    0.187051375745810    1.000000000000000    0.005552099195102
        35           38    4.252563729306981    0.187751971724413    1.000000000000000    0.003818289531662
        36           39    4.252525443525409    0.038510187006502    1.000000000000000    0.002318798281001
        37           40    4.252495780515014    0.111536687937493    1.000000000000000    0.002339592204763
        38           41    4.252449869664952    0.075209329681540    1.000000000000000    0.003900154283738
        39           42    4.252372953365986    0.227159621714901    1.000000000000000    0.003235353892824
        40           43    4.252295989788728    0.189432931845678    1.000000000000000    0.003467251018636
        41           44    4.252217801207405    0.353383110374075    1.000000000000000    0.004778611687646
        42           45    4.252151634195524    0.069034490709467    1.000000000000000    0.002368302388939
        43           46    4.252101899645215    0.084964976911377    1.000000000000000    0.002719857463810
        44           47    4.252066212447711    0.049999164475890    1.000000000000000    0.001924582142028
        45           48    4.252020282350948    0.159756825297205    1.000000000000000    0.002030764579141
        46           49    4.251979534227186    0.096491528894938    1.000000000000000    0.001727683297157
        47           50    4.251942136863611    0.130996606893827    1.000000000000000    0.001588835051720
        48           51    4.251902300763794    0.094513920318390    1.000000000000000    0.001851390706232
        49           52    4.251877227296149    0.073399771698317    1.000000000000000    0.000989289960996
        50           53    4.251863067238861    0.043325911499629    1.000000000000000    0.000907718061104
        51           54    4.251843955092923    0.060798138607474    1.000000000000000    0.001004532107048
        52           55    4.251829263172762    0.060308855130778    1.000000000000000    0.000803398217886
        53           56    4.251816889324980    0.073359639183568    1.000000000000000    0.001400898178854
        54           57    4.251807358811639    0.047280775565207    1.000000000000000    0.000722681825122
        55           58    4.251799151189002    0.059761290253277    1.000000000000000    0.000683453839805
        56           59    4.251789727805778    0.046557825132293    1.000000000000000    0.000957585415523
        57           60    4.251777057058136    0.100927084321845    1.000000000000000    0.000585847467802
        58           61    4.251771489340799    0.046403451936423    1.000000000000000    0.000643861892600
        59           62    4.251767413769501    0.027445652214232    1.000000000000000    0.000421294300668
        60           63    4.251764553670160    0.017718522143373    1.000000000000000    0.000420845195043
        61           64    4.251760530616032    0.031145763231529    1.000000000000000    0.000374567183070
        62           65    4.251756649616591    0.060638658996377    1.000000000000000    0.000688972731939
        63           66    4.251753598957125    0.025778029988963    1.000000000000000    0.000308017505235
        64           67    4.251752126679699    0.015422377612270    1.000000000000000    0.000281070385066
        65           68    4.251749918687082    0.033433040685870    1.000000000000000    0.000309251360377
        66           69    4.251747397679871    0.050360338875416    1.000000000000000    0.000342243422043
        67           70    4.251745321222741    0.043826196568132    1.000000000000000    0.000240656467547
        68           71    4.251743660385329    0.031365705084375    1.000000000000000    0.000238779282980
        69           72    4.251741438794764    0.041748269070473    1.000000000000000    0.000360514446368
        70           73    4.251739212111604    0.042036316185979    1.000000000000000    0.000305518557119
        71           74    4.251737095388631    0.038615157212238    1.000000000000000    0.000243472100587
        72           75    4.251734677697583    0.059126569921640    1.000000000000000    0.000344607724111
        73           76    4.251732626599144    0.060955245818358    1.000000000000000    0.000341269246902
        74           77    4.251730995368747    0.028036970695034    1.000000000000000    0.000250003447652
        75           78    4.251727410224675    0.087123680369636    1.000000000000000    0.000340634312391
        76           79    4.251724198621522    0.080671394086506    1.000000000000000    0.000334717485439
        77           80    4.251718472364752    0.223619551387190    1.000000000000000    0.000933515771074
        78           81    4.251715657860397    0.057038069661834    1.000000000000000    0.000227276499382
        79           82    4.251714792347624    0.012572561923396    1.000000000000000    0.000189279304386
        80           83    4.251714033464344    0.013785327275592    1.000000000000000    0.000248895297608
        81           84    4.251712603378806    0.038203025743817    1.000000000000000    0.000220887911760
        82           85    4.251710843137319    0.058241107040101    1.000000000000000    0.000323298785351
        83           86    4.251709655991865    0.069407836649791    1.000000000000000    0.000373815116117
        84           87    4.251709381697557    0.006410316047183    1.000000000000000    0.000188575120195
        85           88    4.251709229223189    0.004785484464415    1.000000000000000    0.000111169293489
        86           89    4.251709041639296    0.005151443334136    1.000000000000000    0.000147043618517
        87           90    4.251708655336892    0.013012196362558    1.000000000000000    0.000269330810107
        88           91    4.251708205365214    0.018409866745460    1.000000000000000    0.000312595573969
        89           92    4.251707392792352    0.033856024787159    1.000000000000000    0.000292789323474
        90           93    4.251706286422043    0.072169993401864    1.000000000000000    0.000222818141386
        91           94    4.251705457870007    0.032808748416035    1.000000000000000    0.000151713555204
        92           95    4.251704808603881    0.025015626619895    1.000000000000000    0.000209839772176
        93           96    4.251704134034203    0.028265948092322    1.000000000000000    0.000240787980465
        94           97    4.251702766374729    0.063525680033602    1.000000000000000    0.000234746368795
        95           98    4.251700701913623    0.129389062120329    1.000000000000000    0.000251789329796
        96           99    4.251699532865716    0.073351539789823    1.000000000000000    0.000263401422693
        97          100    4.251698517409605    0.064363814864282    1.000000000000000    0.000271768082447
        98          101    4.251697279556261    0.083012023641735    1.000000000000000    0.000262319376794
        99          102    4.251695914220581    0.113287220441505    1.000000000000000    0.000179837250647
       100          103    4.251694818183075    0.081719850290108    1.000000000000000    0.000130136512129
       101          104    4.251693742823175    0.075429919492989    1.000000000000000    0.000223565612084
       102          105    4.251692901475847    0.067448301408224    1.000000000000000    0.000191571650113
       103          107    4.251692360765087    0.060626392244881    0.472294634740309    0.000504186425587
       104          108    4.251691373793339    0.072775910165032    1.000000000000000    0.000197334592953
       105          109    4.251690259281615    0.102891203566813    1.000000000000000    0.000361055218669
       106          110    4.251689484785969    0.087249345705219    1.000000000000000    0.000389732817430
       107          111    4.251687444714299    0.213783198933386    1.000000000000000    0.000766661070881
       108          112    4.251684201930961    0.468282601844956    1.000000000000000    0.000575867214611
       109          113    4.251682246291065    0.198106075075080    1.000000000000000    0.000402164934095
       110          114    4.251680366847327    0.265369786981013    1.000000000000000    0.000412710852693
       111          115    4.251677286205090    0.553178194701586    1.000000000000000    0.000496250450906
       112          117    4.251673045259274    0.738342381330576    0.322746581989938    0.001289970753518
       113          120    4.251670472821707    0.489880991480263    0.109589171887569    0.002242663222103
       114          121    4.251662918200415    0.535691158636034    1.000000000000000    0.002463823751732
       115          122    4.251651582090165    0.068016910448122    1.000000000000000    0.001212548347429
       116          124    4.251644589993713    0.350874007522510    0.497172213668985    0.001379519004908
       117          125    4.251635879316781    0.169218728597959    1.000000000000000    0.001459073732529
       118          126    4.251630585381564    0.043974199697671    1.000000000000000    0.000735650092309
       119          127    4.251624068178083    0.213234528670027    1.000000000000000    0.000828695494188
       120          129    4.251621780880916    0.036052230165319    0.406554451304708    0.001094355104965
       121          130    4.251618893648641    0.035504791343384    1.000000000000000    0.000884627979344
       122          131    4.251617140388190    0.140750124441069    1.000000000000000    0.000511446499682
       123          132    4.251616316091691    0.079637866798632    1.000000000000000    0.001465414312522
       124          133    4.251614736166818    0.004193602984477    1.000000000000000    0.000653246641929
       125          134    4.251613770911467    0.013342372534018    1.000000000000000    0.000328557482233
       126          135    4.251612995534733    0.011290862191195    1.000000000000000    0.000435551861711
       127          136    4.251611476413133    0.017115316787535    1.000000000000000    0.000603110392150
       128          137    4.251608801848088    0.033573109107556    1.000000000000000    0.000650068549292
       129          139    4.251607774727153    0.018481804418313    0.245427146187072    0.001015281136110
       130          140    4.251605063968205    0.033128828389907    1.000000000000000    0.000672122938249
       131          141    4.251602082509277    0.042365503337230    1.000000000000000    0.000458675208012
       132          142    4.251599641151909    0.050917815312109    1.000000000000000    0.000628475294826
       133          143    4.251598284108014    0.040813482894123    1.000000000000000    0.000761232107703
       134          144    4.251597269317656    0.012710119650069    1.000000000000000    0.000375268838006
       135          145    4.251596214242986    0.013263915497035    1.000000000000000    0.000391254087779
       136          146    4.251595395123998    0.015354712249528    1.000000000000000    0.000446557772364
       137          147    4.251593690431252    0.043558310233497    1.000000000000000    0.000554517840376
       138          148    4.251592763201969    0.051481672141239    1.000000000000000    0.000769212173910
       139          149    4.251591481647089    0.009830847332818    1.000000000000000    0.000325532561492
       140          150    4.251590334415099    0.034409027399568    1.000000000000000    0.000438034807754
       141          151    4.251589064708536    0.022434566228072    1.000000000000000    0.000553819481277
       142          152    4.251587330508874    0.049724526972081    1.000000000000000    0.000462355093948
       143          154    4.251586686541087    0.028216871173248    0.277345018124660    0.000655048005937
       144          155    4.251585407122236    0.028232360028175    1.000000000000000    0.000549808818234
       145          156    4.251583888086684    0.034340962924896    1.000000000000000    0.000446894050585
       146          157    4.251582329043967    0.038136126064698    1.000000000000000    0.000511671379294
       147          158    4.251579836424314    0.054095504218892    1.000000000000000    0.000663233261559
       148          159    4.251576900444921    0.068449475792932    1.000000000000000    0.000472527690688
       149          160    4.251575183191259    0.076264951443114    1.000000000000000    0.000445603506642
       150          161    4.251573905844351    0.028312482487905    1.000000000000000    0.000378383671813
       151          162    4.251572696019768    0.035296750731881    1.000000000000000    0.000335869918576
       152          163    4.251571048821054    0.051204579194595    1.000000000000000    0.000302549235052
       153          164    4.251569618562685    0.059505636041743    1.000000000000000    0.000351945453036
       154          165    4.251567954476541    0.053608431133903    1.000000000000000    0.000377529827800
       155          166    4.251565698860706    0.049536477326209    1.000000000000000    0.000353211091428
       156          167    4.251562691082747    0.089587591381729    1.000000000000000    0.000851092761910
       157          168    4.251559900115558    0.059758752200248    1.000000000000000    0.000403294901668
       158          169    4.251558007621036    0.031986924061029    1.000000000000000    0.000335379228964
       159          170    4.251555547528452    0.064904726926057    1.000000000000000    0.000309685478184
       160          171    4.251554520211797    0.151594963450547    1.000000000000000    0.000807628750750
       161          172    4.251552698573541    0.020444758342729    1.000000000000000    0.000352959984817
       162          173    4.251551565282630    0.018416138776676    1.000000000000000    0.000323739364489
       163          174    4.251550138033518    0.041031839376162    1.000000000000000    0.000375544792881
       164          175    4.251547420626826    0.079753612534099    1.000000000000000    0.000409882649909
       165          176    4.251543583893901    0.176325024805574    1.000000000000000    0.000773225127048
       166          177    4.251540669409482    0.213614100561539    1.000000000000000    0.000551274253065
       167          178    4.251538073966209    0.044608596524182    1.000000000000000    0.000329131417914
       168          179    4.251536609930797    0.034114692133183    1.000000000000000    0.000239403158234
       169          180    4.251535554670480    0.050306801659572    1.000000000000000    0.000268872533796
       170          181    4.251534771209931    0.083712165948618    1.000000000000000    0.000376463621139
       171          182    4.251533985841997    0.049639792270482    1.000000000000000    0.000174344486664
       172          183    4.251533746041955    0.009269494739702    1.000000000000000    0.000125855101243
       173          184    4.251533305666405    0.015456832492193    1.000000000000000    0.000145752911360
       174          185    4.251532557155025    0.033269925732646    1.000000000000000    0.000205579549705
       175          186    4.251531705183901    0.040863516536631    1.000000000000000    0.000295538120502
       176          187    4.251530655514414    0.068155178489294    1.000000000000000    0.000168371114224
       177          188    4.251529837251245    0.028192732238642    1.000000000000000    0.000161720076913
       178          189    4.251528642852360    0.051164753794612    1.000000000000000    0.000267410111547
       179          190    4.251527684558893    0.049563248993250    1.000000000000000    0.000329009758303
       180          191    4.251527291677610    0.124912163561382    1.000000000000000    0.000868429864725
       181          192    4.251525417766734    0.027330940948566    1.000000000000000    0.000237146692942
       182          193    4.251524641706979    0.032372425259927    1.000000000000000    0.000188536619780
       183          194    4.251523869510598    0.054067030531219    1.000000000000000    0.000258897218529
       184          195    4.251523069329348    0.060889328761890    1.000000000000000    0.000247088301250
       185          196    4.251521715728448    0.126624321522893    1.000000000000000    0.000665574079904
       186          197    4.251520611154699    0.076633564331236    1.000000000000000    0.000323386262148
       187          198    4.251519998161647    0.022000768645136    1.000000000000000    0.000231806743350
       188          199    4.251519066671167    0.039819635676457    1.000000000000000    0.000204851153405
       189          200    4.251517840839541    0.065935094180492    1.000000000000000    0.000279630150618
       190          201    4.251516408339857    0.120235605229306    1.000000000000000    0.000279518798938
       191          202    4.251515119867171    0.150704269298471    1.000000000000000    0.000353091913736
       192          203    4.251513089924577    0.154408941115297    1.000000000000000    0.000391100533414
       193          204    4.251511421560789    0.117757045243776    1.000000000000000    0.000270289902428
       194          205    4.251510411418379    0.105302056329069    1.000000000000000    0.000348903220940
       195          206    4.251509351173149    0.080437892977208    1.000000000000000    0.000293610657618
       196          207    4.251507645624788    0.145680658082357    1.000000000000000    0.000236305636968
       197          208    4.251505918330969    0.181747647984936    1.000000000000000    0.000267468866486
       198          209    4.251504877716106    0.126086820630608    1.000000000000000    0.000285492758871
       199          210    4.251504263216602    0.017799908483712    1.000000000000000    0.000144209066109
       200          211    4.251503840683565    0.013696182703049    1.000000000000000    0.000110873849845
       201          212    4.251503346873792    0.023375906513922    1.000000000000000    0.000134346062753
       202          213    4.251502547612610    0.053444888015849    1.000000000000000    0.000159427545859
       203          214    4.251502389203209    0.084148330613996    1.000000000000000    0.000508116195193
       204          215    4.251501944061870    0.027770230393575    1.000000000000000    0.000119932911613
       205          216    4.251501802781791    0.009127538437821    1.000000000000000    0.000083485604475
       206          217    4.251501735410281    0.022671558135198    1.000000000000000    0.000404239096267
       207          218    4.251501561416945    0.006077258987434    1.000000000000000    0.000140122662189
       208          219    4.251501475017360    0.005975268036240    1.000000000000000    0.000078247444869
       209          220    4.251501377846313    0.011329363454611    1.000000000000000    0.000108063560450
       210          221    4.251501276463229    0.009414903508887    1.000000000000000    0.000102029365353
       211          222    4.251501008293915    0.020030759598815    1.000000000000000    0.000090552795078
       212          223    4.251500833638430    0.043285835231676    1.000000000000000    0.000332704983597
       213          224    4.251500469320018    0.020653067154943    1.000000000000000    0.000130128755558
       214          225    4.251500233025476    0.015758932081960    1.000000000000000    0.000154753415355
       215          226    4.251499842002034    0.033461663586663    1.000000000000000    0.000173446512617
       216          227    4.251499361988322    0.035767167476516    1.000000000000000    0.000164918221998
       217          229    4.251499147735622    0.042022435437797    0.149710753998130    0.000239718197629
       218          230    4.251498691987854    0.037655266600687    1.000000000000000    0.000131670200152
       219          231    4.251498354621222    0.026562789800149    1.000000000000000    0.000137038579350
       220          232    4.251497951256487    0.041615556957306    1.000000000000000    0.000182113548899
       221          233    4.251497729308674    0.045116759277397    1.000000000000000    0.000393987445035
       222          234    4.251497457113448    0.038811993884370    1.000000000000000    0.000205546152711
       223          235    4.251497317764718    0.016631527845790    1.000000000000000    0.000134493886467
       224          236    4.251497115129382    0.012841245620517    1.000000000000000    0.000106867354667
       225          237    4.251496911673634    0.021265908463230    1.000000000000000    0.000152850197010
       226          239    4.251496820663006    0.017516781045536    0.371182140115599    0.000286246569300
       227          240    4.251496607867529    0.035812761655438    1.000000000000000    0.000179889914073
       228          241    4.251496471253304    0.023271038062679    1.000000000000000    0.000091972292305
       229          242    4.251496393138585    0.016119806648227    1.000000000000000    0.000062717798083
       230          243    4.251496339058623    0.004533664682782    1.000000000000000    0.000061754876116
       231          244    4.251496294884415    0.013068346754337    1.000000000000000    0.000176575084107
       232          245    4.251496252025928    0.004755349995961    1.000000000000000    0.000096439462118
       233          246    4.251496230767378    0.003871049214103    1.000000000000000    0.000062830971285
       234          247    4.251496209153517    0.004662743974008    1.000000000000000    0.000055567632922
       235          248    4.251496202929661    0.003994499513727    1.000000000000000    0.000097854599473
       236          249    4.251496191304841    0.002435844500204    1.000000000000000    0.000048589816625
       237          250    4.251496180246585    0.004338119695145    1.000000000000000    0.000034453156180
       238          251    4.251496169827759    0.002892347415567    1.000000000000000    0.000038526847445
       239          252    4.251496148420531    0.004421064684102    1.000000000000000    0.000046406491708
       240          253    4.251496114205707    0.005035321666506    1.000000000000000    0.000050554011169
       241          255    4.251496102154022    0.004116540411907    0.362409842649736    0.000063446274757
       242          256    4.251496080351607    0.003733931774130    1.000000000000000    0.000031306269284
       243          257    4.251496069923789    0.003800385983951    1.000000000000000    0.000028002479047
       244          258    4.251496061600641    0.001602360686889    1.000000000000000    0.000031310295348
       245          259    4.251496056976691    0.002770941696192    1.000000000000000    0.000039745888869
       246          260    4.251496050818085    0.001632720376665    1.000000000000000    0.000017797629395
       247          261    4.251496047750536    0.001308160586461    1.000000000000000    0.000015999189153
       248          262    4.251496043027778    0.001670749491608    1.000000000000000    0.000015994172267
       249          263    4.251496037840495    0.002273701205850    1.000000000000000    0.000035748450803
       250          264    4.251496034180041    0.001985055299950    1.000000000000000    0.000017500958277
       251          265    4.251496031601612    0.001212879669976    1.000000000000000    0.000012982911975
       252          266    4.251496027972284    0.001450792083769    1.000000000000000    0.000019340316953
       253          267    4.251496024088073    0.002087971411344    1.000000000000000    0.000028959799666
       254          268    4.251496019778743    0.001856721364056    1.000000000000000    0.000022457811676
       255          269    4.251496015644146    0.002373542171791    1.000000000000000    0.000014161023132
       256          270    4.251496010953802    0.001981773360541    1.000000000000000    0.000015535724156
       257          271    4.251496006428956    0.002915191348534    1.000000000000000    0.000022735646544
       258          272    4.251496004155081    0.004113362765904    1.000000000000000    0.000041544008248
       259          273    4.251495999447869    0.002540985354199    1.000000000000000    0.000015950463875
       260          274    4.251495996927527    0.000929080841492    1.000000000000000    0.000014804007675
       261          275    4.251495993232195    0.001670361472049    1.000000000000000    0.000019052772663
       262          276    4.251495986819688    0.002859729028969    1.000000000000000    0.000023148072246
       263          277    4.251495982059131    0.008453213165497    1.000000000000000    0.000052264849012
       264          278    4.251495970060869    0.004421194052380    1.000000000000000    0.000025154464889
       265          279    4.251495960114943    0.002785347055080    1.000000000000000    0.000019538641914
       266          280    4.251495942730630    0.008819728429851    1.000000000000000    0.000036839399124
       267          281    4.251495925947310    0.010261452809868    1.000000000000000    0.000055214832947
       268          282    4.251495904812278    0.006976108730198    1.000000000000000    0.000039199372894
       269          283    4.251495863389772    0.016456239151172    1.000000000000000    0.000041898374771
       270          284    4.251495829831733    0.017557517482216    1.000000000000000    0.000074411347549
       271          285    4.251495789312037    0.015626362120192    1.000000000000000    0.000054196094925
       272          286    4.251495749752779    0.017830612063599    1.000000000000000    0.000035725684131
       273          287    4.251495739558101    0.011750926521077    1.000000000000000    0.000057956429819
       274          288    4.251495724152960    0.002711390370751    1.000000000000000    0.000032680314926
       275          289    4.251495707577733    0.003825511977359    1.000000000000000    0.000029935786515
       276          290    4.251495684805704    0.009097591565545    1.000000000000000    0.000036627137511
       277          291    4.251495652163461    0.015292315578692    1.000000000000000    0.000046421475997
       278          292    4.251495626021134    0.029382002697489    1.000000000000000    0.000065144854199
       279          293    4.251495593795292    0.008514813947969    1.000000000000000    0.000039597985273
       280          294    4.251495577150659    0.003361666542577    1.000000000000000    0.000035925508468
       281          295    4.251495549495147    0.008582203291517    1.000000000000000    0.000031545716876
       282          296    4.251495525145529    0.012004236028709    1.000000000000000    0.000027252827971
       283          297    4.251495523773919    0.014235346480287    1.000000000000000    0.000112535933589
       284          298    4.251495501206748    0.005561931179691    1.000000000000000    0.000023897084914
       285          299    4.251495496733912    0.002596073420317    1.000000000000000    0.000018422417254
       286          300    4.251495487291566    0.006381622694057    1.000000000000000    0.000030322057679
       287          301    4.251495481570804    0.008764071991618    1.000000000000000    0.000052877174864
       288          302    4.251495470036481    0.005315426613418    1.000000000000000    0.000024541335386
       289          303    4.251495459822091    0.005475925695570    1.000000000000000    0.000030780966267
       290          304    4.251495449360489    0.005917466740801    1.000000000000000    0.000034374400426
       291          305    4.251495427127449    0.012389571398409    1.000000000000000    0.000032638368428
       292          306    4.251495408282370    0.021682006132631    1.000000000000000    0.000097373827309
       293          307    4.251495380715210    0.007561343212977    1.000000000000000    0.000032345645991
       294          308    4.251495363618560    0.003398180183846    1.000000000000000    0.000033617685225
       295          309    4.251495349935688    0.006236603650670    1.000000000000000    0.000036531046298
       296          310    4.251495324352463    0.013662280392616    1.000000000000000    0.000034386427770
       297          311    4.251495315863429    0.032603060580832    1.000000000000000    0.000088591971514
       298          312    4.251495282549561    0.006679507845056    1.000000000000000    0.000033046033731
       299          313    4.251495268894232    0.002524843386544    1.000000000000000    0.000033329117753
       300          314    4.251495243239735    0.010630851942672    1.000000000000000    0.000046332486113
       301          315    4.251495206516064    0.017849230258136    1.000000000000000    0.000052530690246
       302          316    4.251495152496450    0.049294379858510    1.000000000000000    0.000090394877849
       303          317    4.251495049527470    0.054074076302172    1.000000000000000    0.000069467486578
       304          318    4.251494960534930    0.022283214939464    1.000000000000000    0.000058196204491
       305          319    4.251494814115603    0.065519605776082    1.000000000000000    0.000096994266474
       306          320    4.251494735435657    0.038548885133470    1.000000000000000    0.000112494094613
       307          321    4.251494676475842    0.145717037790319    1.000000000000000    0.000223484738659
       308          322    4.251494527322755    0.026192741816763    1.000000000000000    0.000069833940923
       309          323    4.251494477585331    0.007796310208775    1.000000000000000    0.000058718787055
       310          324    4.251494448027138    0.048396417493395    1.000000000000000    0.000233238507353
       311          325    4.251494356676330    0.008732291428342    1.000000000000000    0.000069934787957
       312          326    4.251494321222828    0.024512444682039    1.000000000000000    0.000064670742065
       313          327    4.251494283813376    0.032428534222037    1.000000000000000    0.000072174483447
       314          328    4.251494213120425    0.034942078663043    1.000000000000000    0.000067787183290
       315          329    4.251494146639198    0.065578340870015    1.000000000000000    0.000097664930721
       316          330    4.251494134817543    0.022533839445675    1.000000000000000    0.000106039482682
       317          331    4.251494102134920    0.026056178732349    1.000000000000000    0.000034389388023
       318          332    4.251494095222832    0.004845393689109    1.000000000000000    0.000027225382391
       319          333    4.251494084898479    0.002339414126556    1.000000000000000    0.000023936053205
       320          334    4.251494076521325    0.006811291135462    1.000000000000000    0.000019612980742
       321          335    4.251494074938406    0.009250632183787    1.000000000000000    0.000040140958944
       322          336    4.251494070805355    0.003528955606650    1.000000000000000    0.000010416473529
       323          337    4.251494069989700    0.000900764888390    1.000000000000000    0.000009092964411
       324          338    4.251494068753731    0.001737712789610    1.000000000000000    0.000019081138927
       325          339    4.251494067782618    0.002268787451843    1.000000000000000    0.000013638892333
       326          340    4.251494066730962    0.001199060407082    1.000000000000000    0.000012593494191
       327          341    4.251494064479918    0.002406157322277    1.000000000000000    0.000015770162658
       328          342    4.251494061981725    0.002562498799902    1.000000000000000    0.000019276248359
       329          343    4.251494058661524    0.006049193881091    1.000000000000000    0.000064229674101
       330          344    4.251494052240455    0.005538345762434    1.000000000000000    0.000028117923716
       331          345    4.251494047082849    0.002594988891514    1.000000000000000    0.000024712251095
       332          346    4.251494039485155    0.004464056520508    1.000000000000000    0.000030225883590
       333          347    4.251494031052622    0.004693223991504    1.000000000000000    0.000036553136890
       334          348    4.251494016534448    0.014051933084132    1.000000000000000    0.000078172332905
       335          349    4.251493999470015    0.013410205861876    1.000000000000000    0.000078377847733
       336          350    4.251493984690252    0.002677121093144    1.000000000000000    0.000048522492897
       337          351    4.251493954857884    0.016515849002870    1.000000000000000    0.000051720324609
       338          352    4.251493931518136    0.014484188957159    1.000000000000000    0.000101969931853
       339          353    4.251493872339288    0.043426611150258    1.000000000000000    0.000122952053816
       340          354    4.251493786289905    0.099019458453128    1.000000000000000    0.000267418958498
       341          355    4.251493657151960    0.054126278275353    1.000000000000000    0.000144037108617
       342          356    4.251493505906723    0.080312752625652    1.000000000000000    0.000097558194947
       343          357    4.251493423815278    0.050160425921812    1.000000000000000    0.000143325007828
       344          358    4.251493290119490    0.087446538698772    1.000000000000000    0.000146613608454
       345          360    4.251493211845960    0.072825949247856    0.402027447289399    0.000249748546813
       346          361    4.251493071397732    0.088091199175163    1.000000000000000    0.000128880504234
       347          362    4.251492951884678    0.075953985696912    1.000000000000000    0.000098959622250
       348          363    4.251492854592014    0.062864296764867    1.000000000000000    0.000144985795374
       349          364    4.251492757390516    0.088114228457120    1.000000000000000    0.000187405604652
       350          365    4.251492656571648    0.061013376110856    1.000000000000000    0.000118778968916
       351          366    4.251492585229469    0.021047849945466    1.000000000000000    0.000086794449957
       352          367    4.251492521006483    0.035925377001568    1.000000000000000    0.000092158062837
       353          368    4.251492485506878    0.027695413635548    1.000000000000000    0.000076308329926
       354          369    4.251492451818911    0.028901219175692    1.000000000000000    0.000056836061824
       355          370    4.251492416853540    0.029021266263919    1.000000000000000    0.000056124335560
       356          371    4.251492384135160    0.024839371647694    1.000000000000000    0.000064287727062
       357          372    4.251492367713270    0.030702717388203    1.000000000000000    0.000105701112103
       358          373    4.251492338644650    0.003916356909217    1.000000000000000    0.000029985264333
       359          374    4.251492331032601    0.005500945473750    1.000000000000000    0.000023427081946
       360          375    4.251492323863335    0.002264397230717    1.000000000000000    0.000024943305656
       361          376    4.251492319706034    0.007455344028620    1.000000000000000    0.000026026992294
       362          377    4.251492316879914    0.005462600884938    1.000000000000000    0.000024859498780
       363          378    4.251492315251908    0.002033802510233    1.000000000000000    0.000012321871002
       364          379    4.251492313750050    0.002607220449547    1.000000000000000    0.000013426330994
       365          380    4.251492312724112    0.000756108297573    1.000000000000000    0.000015154021639
       366          381    4.251492311309680    0.001441195699413    1.000000000000000    0.000007177944796
       367          382    4.251492311055144    0.001027011850148    1.000000000000000    0.000008462682216
       368          383    4.251492310811029    0.001036286240848    1.000000000000000    0.000006224328517
       369          384    4.251492310703972    0.000605857038406    1.000000000000000    0.000004864078051
       370          385    4.251492310519958    0.001248662949667    1.000000000000000    0.000002705272230
       371          386    4.251492310471590    0.001099896479691    1.000000000000000    0.000004426970953
       372          387    4.251492310420609    0.000256395783521    1.000000000000000    0.000002387674748
       373          388    4.251492310374220    0.000242986970646    1.000000000000000    0.000001818463494
       374          389    4.251492310342012    0.000184558757672    1.000000000000000    0.000001788888620
       375          390    4.251492310299771    0.000184558757672    1.000000000000000    0.000001359322936
Convergence criteria met.
After: gradient norm = 1.3593229358580678E-6
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {2.0541,1.4161,-0.0849,-3.3853}

Count Table 1:
---------------
h:                 {1.8507,1.3018,-0.6367,-2.5158}

Count Table 2:
---------------
h:                 {-0.0000,0.0000,-0.0000}

Count Table 3:
---------------
h:                 {0.1360,-0.1360}

Count Table 4:
---------------
h:                 {0.0000,-0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-2.4723,-2.4381,-3.9686}
Activity(exp=1):   {0.0000,-0.0343,-0.8631,0.5841}
Activity(exp=2):   {-0.0000,0.0000,-0.0000}
Activity(exp=3):   {0.0000,-0.2190}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-0.6862,-0.9352,-0.7157,-0.7506,-0.2051,-1.3844,-0.6652,-0.8330,-0.5945,-1.4797,-1.6964,0.6830,-0.3021,-2.5912,0.6159,-0.8102,1.1579,-1.4357,-1.4641,-1.3458,-1.1133,-1.7427,-1.0470,0.8153,-0.9319,-1.8818,-1.3235,1.0495,-0.7733,-2.2420,-0.8053,0.7330,1.5996,-1.9043,-1.0586,-1.7244,-1.8129,-0.3092,-1.7495,0.7839,-1.0714,-1.5257,-0.0712,-0.4194,-0.1913,-1.6296,-0.3340,-0.9328,-1.1196,-0.4910,-0.7429,-0.7342}
Activity(exp=0):   {-0.0000,0.9018,-0.7040,-0.8044}
Activity(exp=1):   {0.0000,0.5721,-0.1438,-2.9094}
Activity(exp=2):   {-0.0000,-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 2:
---------------
Mononucleotide:    {-0.8848,-1.2762,-1.0516,-0.8530,-0.9646,-1.4805,-1.0790,-0.5415,-0.9615,-2.0861,-1.7795,0.7615,-1.0589,-2.5502,0.8685,-1.3250,2.0641,-4.2584,-1.2243,-0.6470,-1.6348,0.0927,-1.8149,-0.7086,0.1027,-2.1917,-0.7107,-1.2659,-1.2654,-1.3482,-0.5928,-0.8592}
Activity(exp=0):   {-0.0000,-0.4837,-0.3282,1.3876}
Activity(exp=1):   {-0.0000,-2.3885,-2.1455,-0.1904}
Activity(exp=2):   {-0.0000,-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,0.0830}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=2, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=3, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=4, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}


==================================
== Starts fiting Binding mode 3 ==
==================================
> Optimizing h (component3-0-h).
>>  Starting new optimization: component3-0-h. (2021-05-22 07:40:52.761).
>>> Packing before optimization
Packing:     {"enrichmentModel":[{},{},{},{},{}],"countTable":[{"h":[0,1,2,3]},{"h":[4,5,6,7]},{"h":[8,9,10]},{"h":[11,12]},{"h":[13,14]}],"bindingModeInteractions":[{}],"bindingModes":[{},{},{},{},{}]}

Value and gradient before optimization:
=======================================
value         = 4.603176206432809
gradient      = {-0.0338,0.0133,0.0151,0.0054,-0.1018,0.0309,-0.0197,0.0907,-0.2350,-0.0827,0.3177,-0.0000,0.0000,0.0000,-0.0000}
gradient norm = 0.4295777111399
Starting Function Value: 4.603176206432809
Iterations   Fnc. Calls           Likelihood       Distance Moved           Step Alpha        Gradient Norm
         1            2    4.319008494697840    1.000000000000000    2.327867517489359    0.171994233102598
         2            3    4.259527551451352    0.777858104739964    1.000000000000000    0.072683612106215
         3            4    4.249155452704818    0.202212343533682    1.000000000000000    0.035117820102449
         4            5    4.243206513362885    0.296462563823622    1.000000000000000    0.011234692326318
         5            6    4.242796444939256    0.099887163348002    1.000000000000000    0.005133057575135
         6            7    4.242746203116359    0.026671378348020    1.000000000000000    0.001286510767462
         7            8    4.242742131812151    0.006976101121952    1.000000000000000    0.000140194068011
         8            9    4.242742057268740    0.000721111469034    1.000000000000000    0.000069738483880
         9           10    4.242742032421516    0.000747392264923    1.000000000000000    0.000015761479149
        10           12    4.242742031964280    0.000061292331625    0.499774175799001    0.000004562713051
        11           13    4.242742031938891    0.000021602358352    1.000000000000000    0.000002813170105
        12           14    4.242742031930480    0.000021602358352    1.000000000000000    0.000000245621591
Convergence criteria met.
After: gradient norm = 2.4562159069823594E-7
>>> Parameters after optimization

Count Table 0:
---------------
h:                 {2.3201,1.3946,-0.2074,-3.5073}

Count Table 1:
---------------
h:                 {2.7163,1.3894,-0.8735,-3.2321}

Count Table 2:
---------------
h:                 {0.9524,0.0066,-0.9590}

Count Table 3:
---------------
h:                 {0.1360,-0.1360}

Count Table 4:
---------------
h:                 {-0.0000,0.0000}

Binding mode 0:
---------------
Mononucleotide:    {}
Activity(exp=0):   {-0.0000,-2.4723,-2.4381,-3.9686}
Activity(exp=1):   {0.0000,-0.0343,-0.8631,0.5841}
Activity(exp=2):   {-0.0000,0.0000,-0.0000}
Activity(exp=3):   {0.0000,-0.2190}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 1:
---------------
Mononucleotide:    {-0.6862,-0.9352,-0.7157,-0.7506,-0.2051,-1.3844,-0.6652,-0.8330,-0.5945,-1.4797,-1.6964,0.6830,-0.3021,-2.5912,0.6159,-0.8102,1.1579,-1.4357,-1.4641,-1.3458,-1.1133,-1.7427,-1.0470,0.8153,-0.9319,-1.8818,-1.3235,1.0495,-0.7733,-2.2420,-0.8053,0.7330,1.5996,-1.9043,-1.0586,-1.7244,-1.8129,-0.3092,-1.7495,0.7839,-1.0714,-1.5257,-0.0712,-0.4194,-0.1913,-1.6296,-0.3340,-0.9328,-1.1196,-0.4910,-0.7429,-0.7342}
Activity(exp=0):   {-0.0000,0.9018,-0.7040,-0.8044}
Activity(exp=1):   {0.0000,0.5721,-0.1438,-2.9094}
Activity(exp=2):   {-0.0000,-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,-0.0000}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 2:
---------------
Mononucleotide:    {-0.8848,-1.2762,-1.0516,-0.8530,-0.9646,-1.4805,-1.0790,-0.5415,-0.9615,-2.0861,-1.7795,0.7615,-1.0589,-2.5502,0.8685,-1.3250,2.0641,-4.2584,-1.2243,-0.6470,-1.6348,0.0927,-1.8149,-0.7086,0.1027,-2.1917,-0.7107,-1.2659,-1.2654,-1.3482,-0.5928,-0.8592}
Activity(exp=0):   {-0.0000,-0.4837,-0.3282,1.3876}
Activity(exp=1):   {-0.0000,-2.3885,-2.1455,-0.1904}
Activity(exp=2):   {-0.0000,-0.0000,-0.0000}
Activity(exp=3):   {-0.0000,0.0830}
Activity(exp=4):   {-0.0000,-0.0000}

Binding mode 3:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.8249,-1.2984,-1.4588,-1.6215}
Activity(exp=1):   {0.7773,0.7377,-0.0856,1.3411}
Activity(exp=2):   {0.7488,0.7488,0.7488}
Activity(exp=3):   {0.7657,0.5525}
Activity(exp=4):   {0.7488,0.7488}

Binding mode 4:
---------------
Mononucleotide:    {0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,-1.0000,-1.0000,-1.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,-1.0000,0.0000,-1.0000,0.0000,0.0000,0.0000,0.0000}
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}

Binding mode interaction 0:
---------------------------
Activity(exp=0):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=1):   {0.0000,0.0000,0.0000,0.0000}
Activity(exp=2):   {0.0000,0.0000,0.0000}
Activity(exp=3):   {0.0000,0.0000}
Activity(exp=4):   {0.0000,0.0000}
Position Matrix(exp=0, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=0, strand 1=1, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=0, strand 2=1):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000}}
Position Matrix(exp=1, strand 1=1, strand 2=0):
{{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000,0.0000},
{0.0000,0.0000,0.0000,0.00